Incidental Mutation 'R0219:Ccdc116'
ID33750
Institutional Source Beutler Lab
Gene Symbol Ccdc116
Ensembl Gene ENSMUSG00000022768
Gene Namecoiled-coil domain containing 116
Synonyms
MMRRC Submission 038468-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0219 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17139064-17147229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17141612 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 404 (R404S)
Ref Sequence ENSEMBL: ENSMUSP00000155923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023452] [ENSMUST00000115709] [ENSMUST00000115711] [ENSMUST00000231597] [ENSMUST00000231726] [ENSMUST00000232033] [ENSMUST00000232540]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023452
AA Change: R404S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023452
Gene: ENSMUSG00000022768
AA Change: R404S

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115709
AA Change: R404S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111374
Gene: ENSMUSG00000022768
AA Change: R404S

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115711
AA Change: R404S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111376
Gene: ENSMUSG00000022768
AA Change: R404S

DomainStartEndE-ValueType
Pfam:DUF4702 18 411 6.3e-223 PFAM
low complexity region 488 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145792
Predicted Effect probably benign
Transcript: ENSMUST00000231597
Predicted Effect probably benign
Transcript: ENSMUST00000231726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231970
Predicted Effect possibly damaging
Transcript: ENSMUST00000232033
AA Change: R404S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232540
AA Change: R404S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.2989 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,886,150 probably benign Het
Acacb T A 5: 114,232,944 M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,811,040 probably benign Het
Ankle2 C T 5: 110,251,645 R624* probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Brca2 A G 5: 150,523,175 probably benign Het
Ccdc171 A G 4: 83,696,441 probably benign Het
Ccdc80 A G 16: 45,096,483 K534R probably damaging Het
Ccna1 T C 3: 55,050,927 I112V probably benign Het
Cdhr1 A C 14: 37,079,601 L795R possibly damaging Het
Cilp C A 9: 65,269,590 L43I possibly damaging Het
Dclk2 T C 3: 86,813,669 probably benign Het
Ddx59 C A 1: 136,432,309 probably benign Het
Dgkd T C 1: 87,938,274 probably benign Het
Dicer1 A G 12: 104,692,125 probably null Het
Dst T G 1: 34,303,478 S5030A probably damaging Het
Dysf G A 6: 84,129,461 probably benign Het
Farp1 C A 14: 121,243,600 P471Q possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer1g A G 1: 171,231,226 V31A possibly damaging Het
Glb1l2 A G 9: 26,806,322 V21A probably benign Het
Gm9912 T C 3: 149,185,495 I1V unknown Het
Guf1 G A 5: 69,559,586 A164T probably damaging Het
Hbb-bs T C 7: 103,826,669 H147R possibly damaging Het
Hnrnpr T A 4: 136,339,163 probably benign Het
Iglon5 A T 7: 43,476,837 V214E probably damaging Het
Isx C A 8: 74,889,961 probably null Het
Kank4 T C 4: 98,778,465 N582D probably benign Het
Kcp T A 6: 29,495,785 R773W probably damaging Het
Kdm4c T C 4: 74,373,620 C825R probably damaging Het
Krt25 G A 11: 99,318,059 T315M probably benign Het
Lrp5 A T 19: 3,597,349 S1298T probably damaging Het
Map3k10 T C 7: 27,656,731 D921G probably damaging Het
Mrgprx1 C A 7: 48,021,546 W151L probably damaging Het
Mylk3 T A 8: 85,355,244 D375V probably damaging Het
Nav3 C T 10: 109,866,930 probably null Het
Ncan A G 8: 70,115,334 S43P probably benign Het
Necab3 G T 2: 154,546,093 Q292K probably benign Het
Nptx2 T C 5: 144,548,140 S148P probably damaging Het
Olfr414 G A 1: 174,430,466 V13I probably benign Het
Olfr520 A T 7: 99,735,928 I262L probably benign Het
Pde6a A G 18: 61,285,935 E794G possibly damaging Het
Pus7 T C 5: 23,775,966 Y133C possibly damaging Het
Rad21l A G 2: 151,654,588 probably benign Het
Rptor A T 11: 119,821,777 probably benign Het
Sart1 C A 19: 5,388,396 A78S probably benign Het
Shkbp1 T C 7: 27,352,061 E191G probably benign Het
Slc6a18 A T 13: 73,674,632 probably null Het
Stxbp5 T C 10: 9,770,528 T147A probably benign Het
Sv2b A G 7: 75,157,267 probably null Het
Syne2 A T 12: 76,042,004 K5045N probably damaging Het
Tmem174 A C 13: 98,636,839 M161R possibly damaging Het
Tmprss7 A G 16: 45,656,457 V814A probably damaging Het
Togaram2 T C 17: 71,714,230 probably benign Het
Tpr T C 1: 150,443,258 probably null Het
Ttn T C 2: 76,900,228 probably benign Het
Ubr4 T A 4: 139,430,257 L2375Q possibly damaging Het
Utp20 T C 10: 88,764,675 E1987G probably damaging Het
Utrn T C 10: 12,684,451 T1365A probably damaging Het
Vmn2r116 T A 17: 23,386,098 Y128* probably null Het
Vmn2r5 A G 3: 64,504,313 V278A probably damaging Het
Vps13d C T 4: 145,105,909 S2809N probably benign Het
Zfp212 G A 6: 47,926,685 R68H probably damaging Het
Zfp442 A T 2: 150,411,240 L33Q probably damaging Het
Zfp629 T C 7: 127,612,083 S185G probably damaging Het
Zfp738 A G 13: 67,683,389 probably benign Het
Other mutations in Ccdc116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ccdc116 APN 16 17141992 missense probably damaging 1.00
IGL01905:Ccdc116 APN 16 17142561 missense probably damaging 0.99
IGL02751:Ccdc116 APN 16 17141972 missense probably benign 0.00
IGL03183:Ccdc116 APN 16 17142854 missense probably benign 0.07
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0122:Ccdc116 UTSW 16 17142734 missense probably damaging 1.00
R1664:Ccdc116 UTSW 16 17142628 missense probably benign 0.02
R1718:Ccdc116 UTSW 16 17141908 missense probably benign
R2921:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2922:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2923:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R4119:Ccdc116 UTSW 16 17142187 missense probably damaging 1.00
R4223:Ccdc116 UTSW 16 17146945 unclassified probably benign
R5000:Ccdc116 UTSW 16 17141793 missense possibly damaging 0.95
R5293:Ccdc116 UTSW 16 17141787 missense possibly damaging 0.92
R5435:Ccdc116 UTSW 16 17142762 missense probably benign 0.38
R6694:Ccdc116 UTSW 16 17142791 missense probably benign 0.44
R7215:Ccdc116 UTSW 16 17139928 missense probably damaging 1.00
R7247:Ccdc116 UTSW 16 17139691 missense possibly damaging 0.89
R7771:Ccdc116 UTSW 16 17139591 missense probably benign 0.00
Z1088:Ccdc116 UTSW 16 17147171 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAGGTTGCTCTAACACCTCCAG -3'
(R):5'- AGCCCAGCTCTAAGGCTTCCATAC -3'

Sequencing Primer
(F):5'- CACCTCTGGATGCAGTGTAG -3'
(R):5'- TACCCACCAACAGGGAGG -3'
Posted On2013-05-09