Incidental Mutation 'R0220:Arpc2'
ID33757
Institutional Source Beutler Lab
Gene Symbol Arpc2
Ensembl Gene ENSMUSG00000006304
Gene Nameactin related protein 2/3 complex, subunit 2
Synonymsp34-Arc, 2210023N03Rik
MMRRC Submission 038469-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0220 (G1)
Quality Score182
Status Not validated
Chromosome1
Chromosomal Location74236084-74268209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74248134 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 38 (F38I)
Ref Sequence ENSEMBL: ENSMUSP00000109451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006467] [ENSMUST00000113819] [ENSMUST00000113820]
Predicted Effect probably damaging
Transcript: ENSMUST00000006467
AA Change: F38I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006467
Gene: ENSMUSG00000006304
AA Change: F38I

DomainStartEndE-ValueType
Pfam:P34-Arc 57 284 3.7e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113819
AA Change: F22I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109450
Gene: ENSMUSG00000006304
AA Change: F22I

DomainStartEndE-ValueType
Pfam:P34-Arc 40 270 4.3e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113820
AA Change: F38I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109451
Gene: ENSMUSG00000006304
AA Change: F38I

DomainStartEndE-ValueType
Pfam:P34-Arc 56 286 4.2e-106 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p34 subunit, has yet to be determined. Two alternatively spliced variants have been characterized to date. Additional alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,148,420 probably null Het
Abcc5 A G 16: 20,369,102 V863A probably benign Het
Anxa6 A C 11: 54,981,762 probably null Het
Armc10 A G 5: 21,661,584 K296R probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bcl6 T A 16: 23,966,219 H677L possibly damaging Het
Bcl7a G A 5: 123,351,919 V49I probably damaging Het
Ccnj T C 19: 40,844,810 L144P probably damaging Het
Cdh8 G T 8: 99,111,679 P510T probably benign Het
Cgnl1 C A 9: 71,724,943 K375N possibly damaging Het
Cubn C A 2: 13,356,709 R1695L probably damaging Het
Cyp3a59 G A 5: 146,098,270 V253I probably benign Het
Cyp4f13 A G 17: 32,929,502 I208T probably damaging Het
Dennd4a A C 9: 64,852,445 E277D probably damaging Het
Depdc1a G A 3: 159,523,905 V625I probably benign Het
Dot1l A T 10: 80,785,858 D448V probably damaging Het
Efhc1 A G 1: 20,967,358 D253G probably damaging Het
Eme1 T A 11: 94,650,258 E246V probably null Het
Foxred1 A G 9: 35,209,453 L128P probably damaging Het
Gm14124 A T 2: 150,268,675 Q428H unknown Het
Gm4787 G T 12: 81,378,648 S245R probably damaging Het
Gm5141 T A 13: 62,774,457 K299N probably damaging Het
Greb1 C A 12: 16,682,286 R1558L probably damaging Het
Ip6k3 A T 17: 27,145,229 F282I probably damaging Het
Kdm2a T C 19: 4,324,919 D288G possibly damaging Het
Kdm4d A T 9: 14,463,122 V480E probably benign Het
Kif26a A T 12: 112,157,390 Q143L probably damaging Het
Klhl41 G A 2: 69,670,485 D97N probably benign Het
Krt34 C T 11: 100,038,693 probably benign Het
Lcn11 A T 2: 25,777,831 H77L probably benign Het
Megf6 G A 4: 154,258,215 R529H probably damaging Het
Mipol1 A G 12: 57,457,150 E368G probably damaging Het
Mtus1 A T 8: 40,994,572 M442K probably damaging Het
Naca T C 10: 128,043,386 probably benign Het
Nbea G A 3: 56,005,303 T1021I probably benign Het
Nfib A T 4: 82,296,776 V530E probably damaging Het
Nptx1 A G 11: 119,544,641 V283A probably damaging Het
Olfr1261 G T 2: 89,993,862 L156F probably benign Het
Olfr190 A T 16: 59,074,732 M116K probably damaging Het
Opn5 A G 17: 42,596,604 V127A probably benign Het
Pcgf6 A G 19: 47,040,090 V291A probably benign Het
Pilrb2 C A 5: 137,871,197 R47L probably benign Het
Prom2 A C 2: 127,541,107 S72A probably benign Het
Sema3e T C 5: 14,164,153 F144S possibly damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smarcc2 A T 10: 128,483,636 D798V probably benign Het
Taf5 T C 19: 47,080,560 S563P probably damaging Het
Topaz1 A G 9: 122,749,303 H426R possibly damaging Het
Tpgs1 T A 10: 79,675,437 C138S possibly damaging Het
Traf1 A T 2: 34,949,103 V70D probably benign Het
Ttn T C 2: 76,811,393 Y13453C probably damaging Het
Ubxn4 T A 1: 128,256,194 V97D possibly damaging Het
Ugt1a8 A T 1: 88,088,335 I157L probably benign Het
Vmn2r13 A T 5: 109,156,466 C700S probably damaging Het
Wee1 A T 7: 110,124,526 D216V probably benign Het
Zc3h4 T C 7: 16,429,273 Y533H unknown Het
Zfp81 A G 17: 33,336,724 I43T possibly damaging Het
Zfp963 A T 8: 69,743,493 Y103* probably null Het
Zfp963 A T 8: 69,743,495 Y103N probably benign Het
Zzef1 G T 11: 72,865,966 D1126Y probably damaging Het
Other mutations in Arpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Arpc2 APN 1 74248179 missense probably benign
R0364:Arpc2 UTSW 1 74236887 missense probably null
R1695:Arpc2 UTSW 1 74248232 missense probably damaging 0.97
R4183:Arpc2 UTSW 1 74248163 missense probably damaging 0.99
R5144:Arpc2 UTSW 1 74248208 missense probably damaging 1.00
R5438:Arpc2 UTSW 1 74236836 missense probably null 1.00
R5775:Arpc2 UTSW 1 74255949 splice site probably null
R6017:Arpc2 UTSW 1 74262486 missense probably benign
R7173:Arpc2 UTSW 1 74264372 missense probably damaging 1.00
R7683:Arpc2 UTSW 1 74263814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGAGTACACTCTGAAAGAAGCCCC -3'
(R):5'- GAATGGAGTTGGAAGCCCCTGTTAG -3'

Sequencing Primer
(F):5'- CTGCATAGGTGGACTCTTTAATAGC -3'
(R):5'- CCCTGTTAGCTGTATAAAGAAGCC -3'
Posted On2013-05-09