Incidental Mutation 'R0220:Wee1'
ID33785
Institutional Source Beutler Lab
Gene Symbol Wee1
Ensembl Gene ENSMUSG00000031016
Gene NameWEE 1 homolog 1 (S. pombe)
SynonymsWee1A
MMRRC Submission 038469-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0220 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location110122046-110143286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110124526 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 216 (D216V)
Ref Sequence ENSEMBL: ENSMUSP00000033326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033326]
Predicted Effect probably benign
Transcript: ENSMUST00000033326
AA Change: D216V

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033326
Gene: ENSMUSG00000031016
AA Change: D216V

DomainStartEndE-ValueType
low complexity region 62 112 N/A INTRINSIC
Pfam:Pkinase_Tyr 298 566 1.9e-26 PFAM
Pfam:Pkinase 298 568 1.7e-61 PFAM
low complexity region 620 631 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210940
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is a tyrosine kinase belonging to the Ser/Thr family of protein kinases. This protein catalyzes the inhibitory tyrosine phosphorylation of CDC2/cyclin B kinase, and appears to coordinate the transition between DNA replication and mitosis by protecting the nucleus from cytoplasmically activated CDC2 kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. Mice homozygous for a knock-out allele exhibit lethality between E3.5 and E7.5 with reduced proliferation, increased apoptosis and abnormal G2/M checkpoint function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,148,420 probably null Het
Abcc5 A G 16: 20,369,102 V863A probably benign Het
Anxa6 A C 11: 54,981,762 probably null Het
Armc10 A G 5: 21,661,584 K296R probably benign Het
Arpc2 T A 1: 74,248,134 F38I probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bcl6 T A 16: 23,966,219 H677L possibly damaging Het
Bcl7a G A 5: 123,351,919 V49I probably damaging Het
Ccnj T C 19: 40,844,810 L144P probably damaging Het
Cdh8 G T 8: 99,111,679 P510T probably benign Het
Cgnl1 C A 9: 71,724,943 K375N possibly damaging Het
Cubn C A 2: 13,356,709 R1695L probably damaging Het
Cyp3a59 G A 5: 146,098,270 V253I probably benign Het
Cyp4f13 A G 17: 32,929,502 I208T probably damaging Het
Dennd4a A C 9: 64,852,445 E277D probably damaging Het
Depdc1a G A 3: 159,523,905 V625I probably benign Het
Dot1l A T 10: 80,785,858 D448V probably damaging Het
Efhc1 A G 1: 20,967,358 D253G probably damaging Het
Eme1 T A 11: 94,650,258 E246V probably null Het
Foxred1 A G 9: 35,209,453 L128P probably damaging Het
Gm14124 A T 2: 150,268,675 Q428H unknown Het
Gm4787 G T 12: 81,378,648 S245R probably damaging Het
Gm5141 T A 13: 62,774,457 K299N probably damaging Het
Greb1 C A 12: 16,682,286 R1558L probably damaging Het
Ip6k3 A T 17: 27,145,229 F282I probably damaging Het
Kdm2a T C 19: 4,324,919 D288G possibly damaging Het
Kdm4d A T 9: 14,463,122 V480E probably benign Het
Kif26a A T 12: 112,157,390 Q143L probably damaging Het
Klhl41 G A 2: 69,670,485 D97N probably benign Het
Krt34 C T 11: 100,038,693 probably benign Het
Lcn11 A T 2: 25,777,831 H77L probably benign Het
Megf6 G A 4: 154,258,215 R529H probably damaging Het
Mipol1 A G 12: 57,457,150 E368G probably damaging Het
Mtus1 A T 8: 40,994,572 M442K probably damaging Het
Naca T C 10: 128,043,386 probably benign Het
Nbea G A 3: 56,005,303 T1021I probably benign Het
Nfib A T 4: 82,296,776 V530E probably damaging Het
Nptx1 A G 11: 119,544,641 V283A probably damaging Het
Olfr1261 G T 2: 89,993,862 L156F probably benign Het
Olfr190 A T 16: 59,074,732 M116K probably damaging Het
Opn5 A G 17: 42,596,604 V127A probably benign Het
Pcgf6 A G 19: 47,040,090 V291A probably benign Het
Pilrb2 C A 5: 137,871,197 R47L probably benign Het
Prom2 A C 2: 127,541,107 S72A probably benign Het
Sema3e T C 5: 14,164,153 F144S possibly damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smarcc2 A T 10: 128,483,636 D798V probably benign Het
Taf5 T C 19: 47,080,560 S563P probably damaging Het
Topaz1 A G 9: 122,749,303 H426R possibly damaging Het
Tpgs1 T A 10: 79,675,437 C138S possibly damaging Het
Traf1 A T 2: 34,949,103 V70D probably benign Het
Ttn T C 2: 76,811,393 Y13453C probably damaging Het
Ubxn4 T A 1: 128,256,194 V97D possibly damaging Het
Ugt1a8 A T 1: 88,088,335 I157L probably benign Het
Vmn2r13 A T 5: 109,156,466 C700S probably damaging Het
Zc3h4 T C 7: 16,429,273 Y533H unknown Het
Zfp81 A G 17: 33,336,724 I43T possibly damaging Het
Zfp963 A T 8: 69,743,493 Y103* probably null Het
Zfp963 A T 8: 69,743,495 Y103N probably benign Het
Zzef1 G T 11: 72,865,966 D1126Y probably damaging Het
Other mutations in Wee1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Wee1 APN 7 110134853 splice site probably null
IGL00981:Wee1 APN 7 110139669 missense probably damaging 1.00
IGL01017:Wee1 APN 7 110125848 missense possibly damaging 0.93
IGL01357:Wee1 APN 7 110142035 missense probably benign 0.39
IGL01838:Wee1 APN 7 110124537 missense probably benign 0.01
IGL01970:Wee1 APN 7 110139250 missense probably damaging 1.00
IGL02396:Wee1 APN 7 110142093 missense probably damaging 1.00
IGL02511:Wee1 APN 7 110139276 missense possibly damaging 0.55
IGL02884:Wee1 APN 7 110126062 missense probably benign 0.02
IGL03085:Wee1 APN 7 110124598 missense probably damaging 1.00
IGL03221:Wee1 APN 7 110126817 missense probably damaging 1.00
IGL03383:Wee1 APN 7 110139692 missense probably damaging 1.00
R1934:Wee1 UTSW 7 110122491 missense probably benign 0.06
R3110:Wee1 UTSW 7 110130836 missense probably damaging 1.00
R3112:Wee1 UTSW 7 110130836 missense probably damaging 1.00
R3978:Wee1 UTSW 7 110124555 missense probably damaging 1.00
R4348:Wee1 UTSW 7 110130958 missense probably damaging 1.00
R5434:Wee1 UTSW 7 110124569 frame shift probably null
R5435:Wee1 UTSW 7 110124569 frame shift probably null
R5436:Wee1 UTSW 7 110124569 frame shift probably null
R5449:Wee1 UTSW 7 110124569 frame shift probably null
R5566:Wee1 UTSW 7 110126050 nonsense probably null
R5630:Wee1 UTSW 7 110124569 frame shift probably null
R5632:Wee1 UTSW 7 110124569 frame shift probably null
R5685:Wee1 UTSW 7 110124569 frame shift probably null
R5694:Wee1 UTSW 7 110124569 frame shift probably null
R5807:Wee1 UTSW 7 110124569 frame shift probably null
R5941:Wee1 UTSW 7 110124569 frame shift probably null
R6044:Wee1 UTSW 7 110139306 missense probably benign 0.00
R6163:Wee1 UTSW 7 110135651 missense probably damaging 1.00
R6826:Wee1 UTSW 7 110124663 critical splice donor site probably null
R7203:Wee1 UTSW 7 110134794 missense probably benign 0.00
R7835:Wee1 UTSW 7 110130878 nonsense probably null
R7918:Wee1 UTSW 7 110130878 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCCCCAAGTCGGGTAACGGAAC -3'
(R):5'- CCTTAGGTGTGCAGAGGAACCAAAC -3'

Sequencing Primer
(F):5'- GAGCTTCATTCACAATGTGCTG -3'
(R):5'- TGTGCAGAGGAACCAAACTATAC -3'
Posted On2013-05-09