Incidental Mutation 'R0220:Olfr190'
ID33814
Institutional Source Beutler Lab
Gene Symbol Olfr190
Ensembl Gene ENSMUSG00000064006
Gene Nameolfactory receptor 190
SynonymsMOR183-4, GA_x54KRFPKG5P-55303207-55302284
MMRRC Submission 038469-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0220 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59067140-59078005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59074732 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 116 (M116K)
Ref Sequence ENSEMBL: ENSMUSP00000148991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071243] [ENSMUST00000206214] [ENSMUST00000215687] [ENSMUST00000216495]
Predicted Effect probably damaging
Transcript: ENSMUST00000071243
AA Change: M116K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071224
Gene: ENSMUSG00000064006
AA Change: M116K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-46 PFAM
Pfam:7tm_1 39 288 2.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206214
AA Change: M116K
Predicted Effect probably damaging
Transcript: ENSMUST00000215687
AA Change: M116K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216495
AA Change: M116K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,148,420 probably null Het
Abcc5 A G 16: 20,369,102 V863A probably benign Het
Anxa6 A C 11: 54,981,762 probably null Het
Armc10 A G 5: 21,661,584 K296R probably benign Het
Arpc2 T A 1: 74,248,134 F38I probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bcl6 T A 16: 23,966,219 H677L possibly damaging Het
Bcl7a G A 5: 123,351,919 V49I probably damaging Het
Ccnj T C 19: 40,844,810 L144P probably damaging Het
Cdh8 G T 8: 99,111,679 P510T probably benign Het
Cgnl1 C A 9: 71,724,943 K375N possibly damaging Het
Cubn C A 2: 13,356,709 R1695L probably damaging Het
Cyp3a59 G A 5: 146,098,270 V253I probably benign Het
Cyp4f13 A G 17: 32,929,502 I208T probably damaging Het
Dennd4a A C 9: 64,852,445 E277D probably damaging Het
Depdc1a G A 3: 159,523,905 V625I probably benign Het
Dot1l A T 10: 80,785,858 D448V probably damaging Het
Efhc1 A G 1: 20,967,358 D253G probably damaging Het
Eme1 T A 11: 94,650,258 E246V probably null Het
Foxred1 A G 9: 35,209,453 L128P probably damaging Het
Gm14124 A T 2: 150,268,675 Q428H unknown Het
Gm4787 G T 12: 81,378,648 S245R probably damaging Het
Gm5141 T A 13: 62,774,457 K299N probably damaging Het
Greb1 C A 12: 16,682,286 R1558L probably damaging Het
Ip6k3 A T 17: 27,145,229 F282I probably damaging Het
Kdm2a T C 19: 4,324,919 D288G possibly damaging Het
Kdm4d A T 9: 14,463,122 V480E probably benign Het
Kif26a A T 12: 112,157,390 Q143L probably damaging Het
Klhl41 G A 2: 69,670,485 D97N probably benign Het
Krt34 C T 11: 100,038,693 probably benign Het
Lcn11 A T 2: 25,777,831 H77L probably benign Het
Megf6 G A 4: 154,258,215 R529H probably damaging Het
Mipol1 A G 12: 57,457,150 E368G probably damaging Het
Mtus1 A T 8: 40,994,572 M442K probably damaging Het
Naca T C 10: 128,043,386 probably benign Het
Nbea G A 3: 56,005,303 T1021I probably benign Het
Nfib A T 4: 82,296,776 V530E probably damaging Het
Nptx1 A G 11: 119,544,641 V283A probably damaging Het
Olfr1261 G T 2: 89,993,862 L156F probably benign Het
Opn5 A G 17: 42,596,604 V127A probably benign Het
Pcgf6 A G 19: 47,040,090 V291A probably benign Het
Pilrb2 C A 5: 137,871,197 R47L probably benign Het
Prom2 A C 2: 127,541,107 S72A probably benign Het
Sema3e T C 5: 14,164,153 F144S possibly damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smarcc2 A T 10: 128,483,636 D798V probably benign Het
Taf5 T C 19: 47,080,560 S563P probably damaging Het
Topaz1 A G 9: 122,749,303 H426R possibly damaging Het
Tpgs1 T A 10: 79,675,437 C138S possibly damaging Het
Traf1 A T 2: 34,949,103 V70D probably benign Het
Ttn T C 2: 76,811,393 Y13453C probably damaging Het
Ubxn4 T A 1: 128,256,194 V97D possibly damaging Het
Ugt1a8 A T 1: 88,088,335 I157L probably benign Het
Vmn2r13 A T 5: 109,156,466 C700S probably damaging Het
Wee1 A T 7: 110,124,526 D216V probably benign Het
Zc3h4 T C 7: 16,429,273 Y533H unknown Het
Zfp81 A G 17: 33,336,724 I43T possibly damaging Het
Zfp963 A T 8: 69,743,493 Y103* probably null Het
Zfp963 A T 8: 69,743,495 Y103N probably benign Het
Zzef1 G T 11: 72,865,966 D1126Y probably damaging Het
Other mutations in Olfr190
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr190 APN 16 59074689 nonsense probably null
IGL01011:Olfr190 APN 16 59074430 missense probably benign 0.10
IGL01453:Olfr190 APN 16 59074769 missense probably benign 0.00
IGL01978:Olfr190 APN 16 59074267 missense probably benign 0.33
IGL02348:Olfr190 APN 16 59074949 missense probably damaging 0.99
IGL02423:Olfr190 APN 16 59074267 missense probably benign 0.33
IGL02628:Olfr190 APN 16 59074792 missense probably benign 0.01
R0471:Olfr190 UTSW 16 59074270 missense probably benign 0.01
R1697:Olfr190 UTSW 16 59074907 missense probably damaging 1.00
R3009:Olfr190 UTSW 16 59074987 missense probably benign 0.01
R3011:Olfr190 UTSW 16 59074987 missense probably benign 0.01
R3027:Olfr190 UTSW 16 59074967 missense probably benign 0.00
R4080:Olfr190 UTSW 16 59074256 missense probably damaging 0.96
R4482:Olfr190 UTSW 16 59074923 missense probably benign 0.02
R4895:Olfr190 UTSW 16 59074657 missense probably benign 0.09
R5409:Olfr190 UTSW 16 59074196 missense possibly damaging 0.94
R5825:Olfr190 UTSW 16 59074661 missense probably benign 0.01
R6146:Olfr190 UTSW 16 59074714 missense probably benign 0.05
R6249:Olfr190 UTSW 16 59074432 missense probably damaging 1.00
R6996:Olfr190 UTSW 16 59074192 missense probably benign 0.00
R7283:Olfr190 UTSW 16 59074192 missense probably benign
R7707:Olfr190 UTSW 16 59074271 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCACCACAGGTAGAGAAAGCCTTC -3'
(R):5'- TTACAGGGCTCACAGAGTCTCCAG -3'

Sequencing Primer
(F):5'- GGTAGAGAAAGCCTTCTTCATGC -3'
(R):5'- AGTCTCCAGAGCTACAGGTG -3'
Posted On2013-05-09