Incidental Mutation 'R0220:Ip6k3'
ID33815
Institutional Source Beutler Lab
Gene Symbol Ip6k3
Ensembl Gene ENSMUSG00000024210
Gene Nameinositol hexaphosphate kinase 3
SynonymsD830007E07Rik, Ihpk3
MMRRC Submission 038469-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0220 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27143969-27167764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27145229 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 282 (F282I)
Ref Sequence ENSEMBL: ENSMUSP00000025046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025046]
Predicted Effect probably damaging
Transcript: ENSMUST00000025046
AA Change: F282I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025046
Gene: ENSMUSG00000024210
AA Change: F282I

DomainStartEndE-ValueType
Pfam:IPK 193 390 3e-68 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cerebellar Purkinje cell morphology, reduced synapse number, and defects in motor learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,148,420 probably null Het
Abcc5 A G 16: 20,369,102 V863A probably benign Het
Anxa6 A C 11: 54,981,762 probably null Het
Armc10 A G 5: 21,661,584 K296R probably benign Het
Arpc2 T A 1: 74,248,134 F38I probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bcl6 T A 16: 23,966,219 H677L possibly damaging Het
Bcl7a G A 5: 123,351,919 V49I probably damaging Het
Ccnj T C 19: 40,844,810 L144P probably damaging Het
Cdh8 G T 8: 99,111,679 P510T probably benign Het
Cgnl1 C A 9: 71,724,943 K375N possibly damaging Het
Cubn C A 2: 13,356,709 R1695L probably damaging Het
Cyp3a59 G A 5: 146,098,270 V253I probably benign Het
Cyp4f13 A G 17: 32,929,502 I208T probably damaging Het
Dennd4a A C 9: 64,852,445 E277D probably damaging Het
Depdc1a G A 3: 159,523,905 V625I probably benign Het
Dot1l A T 10: 80,785,858 D448V probably damaging Het
Efhc1 A G 1: 20,967,358 D253G probably damaging Het
Eme1 T A 11: 94,650,258 E246V probably null Het
Foxred1 A G 9: 35,209,453 L128P probably damaging Het
Gm14124 A T 2: 150,268,675 Q428H unknown Het
Gm4787 G T 12: 81,378,648 S245R probably damaging Het
Gm5141 T A 13: 62,774,457 K299N probably damaging Het
Greb1 C A 12: 16,682,286 R1558L probably damaging Het
Kdm2a T C 19: 4,324,919 D288G possibly damaging Het
Kdm4d A T 9: 14,463,122 V480E probably benign Het
Kif26a A T 12: 112,157,390 Q143L probably damaging Het
Klhl41 G A 2: 69,670,485 D97N probably benign Het
Krt34 C T 11: 100,038,693 probably benign Het
Lcn11 A T 2: 25,777,831 H77L probably benign Het
Megf6 G A 4: 154,258,215 R529H probably damaging Het
Mipol1 A G 12: 57,457,150 E368G probably damaging Het
Mtus1 A T 8: 40,994,572 M442K probably damaging Het
Naca T C 10: 128,043,386 probably benign Het
Nbea G A 3: 56,005,303 T1021I probably benign Het
Nfib A T 4: 82,296,776 V530E probably damaging Het
Nptx1 A G 11: 119,544,641 V283A probably damaging Het
Olfr1261 G T 2: 89,993,862 L156F probably benign Het
Olfr190 A T 16: 59,074,732 M116K probably damaging Het
Opn5 A G 17: 42,596,604 V127A probably benign Het
Pcgf6 A G 19: 47,040,090 V291A probably benign Het
Pilrb2 C A 5: 137,871,197 R47L probably benign Het
Prom2 A C 2: 127,541,107 S72A probably benign Het
Sema3e T C 5: 14,164,153 F144S possibly damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smarcc2 A T 10: 128,483,636 D798V probably benign Het
Taf5 T C 19: 47,080,560 S563P probably damaging Het
Topaz1 A G 9: 122,749,303 H426R possibly damaging Het
Tpgs1 T A 10: 79,675,437 C138S possibly damaging Het
Traf1 A T 2: 34,949,103 V70D probably benign Het
Ttn T C 2: 76,811,393 Y13453C probably damaging Het
Ubxn4 T A 1: 128,256,194 V97D possibly damaging Het
Ugt1a8 A T 1: 88,088,335 I157L probably benign Het
Vmn2r13 A T 5: 109,156,466 C700S probably damaging Het
Wee1 A T 7: 110,124,526 D216V probably benign Het
Zc3h4 T C 7: 16,429,273 Y533H unknown Het
Zfp81 A G 17: 33,336,724 I43T possibly damaging Het
Zfp963 A T 8: 69,743,493 Y103* probably null Het
Zfp963 A T 8: 69,743,495 Y103N probably benign Het
Zzef1 G T 11: 72,865,966 D1126Y probably damaging Het
Other mutations in Ip6k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Ip6k3 APN 17 27151060 missense probably benign
R0200:Ip6k3 UTSW 17 27145025 missense probably damaging 1.00
R1448:Ip6k3 UTSW 17 27145268 missense possibly damaging 0.90
R1749:Ip6k3 UTSW 17 27145079 missense probably benign 0.00
R1956:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R1957:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R3125:Ip6k3 UTSW 17 27157542 missense probably damaging 1.00
R3798:Ip6k3 UTSW 17 27145106 missense probably benign 0.01
R3806:Ip6k3 UTSW 17 27145000 missense probably damaging 1.00
R4445:Ip6k3 UTSW 17 27145102 missense probably benign 0.10
R4506:Ip6k3 UTSW 17 27145180 missense possibly damaging 0.69
R4651:Ip6k3 UTSW 17 27145291 missense probably damaging 1.00
R5972:Ip6k3 UTSW 17 27149960 missense possibly damaging 0.48
R6119:Ip6k3 UTSW 17 27148625 missense possibly damaging 0.72
R7140:Ip6k3 UTSW 17 27144995 missense probably damaging 1.00
R7340:Ip6k3 UTSW 17 27148530 missense probably benign 0.00
R7811:Ip6k3 UTSW 17 27157583 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGTGAGCGAAGTCAATCATCCG -3'
(R):5'- TGCTGCTCCTGTAGAACAGGCAAG -3'

Sequencing Primer
(F):5'- AGTGACGCCGCCAGAAG -3'
(R):5'- acttctgattctcctgcctg -3'
Posted On2013-05-09