Incidental Mutation 'R0220:Cyp4f13'
ID33816
Institutional Source Beutler Lab
Gene Symbol Cyp4f13
Ensembl Gene ENSMUSG00000024055
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 13
Synonyms0610030I10Rik, P450 CYP4F13, leukotriene B4 omega hydroxylase
MMRRC Submission 038469-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0220 (G1)
Quality Score163
Status Not validated
Chromosome17
Chromosomal Location32924688-32947402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32929502 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 208 (I208T)
Ref Sequence ENSEMBL: ENSMUSP00000123282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075253] [ENSMUST00000137222] [ENSMUST00000139353] [ENSMUST00000141325] [ENSMUST00000145683]
Predicted Effect probably damaging
Transcript: ENSMUST00000075253
AA Change: I317T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074733
Gene: ENSMUSG00000024055
AA Change: I317T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 514 1.9e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123653
Predicted Effect probably benign
Transcript: ENSMUST00000137222
SMART Domains Protein: ENSMUSP00000123495
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139353
AA Change: I208T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123282
Gene: ENSMUSG00000024055
AA Change: I208T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 60 405 7.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141325
SMART Domains Protein: ENSMUSP00000117168
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145683
SMART Domains Protein: ENSMUSP00000118919
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F3, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F8, is approximately 18 kb away. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,148,420 probably null Het
Abcc5 A G 16: 20,369,102 V863A probably benign Het
Anxa6 A C 11: 54,981,762 probably null Het
Armc10 A G 5: 21,661,584 K296R probably benign Het
Arpc2 T A 1: 74,248,134 F38I probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bcl6 T A 16: 23,966,219 H677L possibly damaging Het
Bcl7a G A 5: 123,351,919 V49I probably damaging Het
Ccnj T C 19: 40,844,810 L144P probably damaging Het
Cdh8 G T 8: 99,111,679 P510T probably benign Het
Cgnl1 C A 9: 71,724,943 K375N possibly damaging Het
Cubn C A 2: 13,356,709 R1695L probably damaging Het
Cyp3a59 G A 5: 146,098,270 V253I probably benign Het
Dennd4a A C 9: 64,852,445 E277D probably damaging Het
Depdc1a G A 3: 159,523,905 V625I probably benign Het
Dot1l A T 10: 80,785,858 D448V probably damaging Het
Efhc1 A G 1: 20,967,358 D253G probably damaging Het
Eme1 T A 11: 94,650,258 E246V probably null Het
Foxred1 A G 9: 35,209,453 L128P probably damaging Het
Gm14124 A T 2: 150,268,675 Q428H unknown Het
Gm4787 G T 12: 81,378,648 S245R probably damaging Het
Gm5141 T A 13: 62,774,457 K299N probably damaging Het
Greb1 C A 12: 16,682,286 R1558L probably damaging Het
Ip6k3 A T 17: 27,145,229 F282I probably damaging Het
Kdm2a T C 19: 4,324,919 D288G possibly damaging Het
Kdm4d A T 9: 14,463,122 V480E probably benign Het
Kif26a A T 12: 112,157,390 Q143L probably damaging Het
Klhl41 G A 2: 69,670,485 D97N probably benign Het
Krt34 C T 11: 100,038,693 probably benign Het
Lcn11 A T 2: 25,777,831 H77L probably benign Het
Megf6 G A 4: 154,258,215 R529H probably damaging Het
Mipol1 A G 12: 57,457,150 E368G probably damaging Het
Mtus1 A T 8: 40,994,572 M442K probably damaging Het
Naca T C 10: 128,043,386 probably benign Het
Nbea G A 3: 56,005,303 T1021I probably benign Het
Nfib A T 4: 82,296,776 V530E probably damaging Het
Nptx1 A G 11: 119,544,641 V283A probably damaging Het
Olfr1261 G T 2: 89,993,862 L156F probably benign Het
Olfr190 A T 16: 59,074,732 M116K probably damaging Het
Opn5 A G 17: 42,596,604 V127A probably benign Het
Pcgf6 A G 19: 47,040,090 V291A probably benign Het
Pilrb2 C A 5: 137,871,197 R47L probably benign Het
Prom2 A C 2: 127,541,107 S72A probably benign Het
Sema3e T C 5: 14,164,153 F144S possibly damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smarcc2 A T 10: 128,483,636 D798V probably benign Het
Taf5 T C 19: 47,080,560 S563P probably damaging Het
Topaz1 A G 9: 122,749,303 H426R possibly damaging Het
Tpgs1 T A 10: 79,675,437 C138S possibly damaging Het
Traf1 A T 2: 34,949,103 V70D probably benign Het
Ttn T C 2: 76,811,393 Y13453C probably damaging Het
Ubxn4 T A 1: 128,256,194 V97D possibly damaging Het
Ugt1a8 A T 1: 88,088,335 I157L probably benign Het
Vmn2r13 A T 5: 109,156,466 C700S probably damaging Het
Wee1 A T 7: 110,124,526 D216V probably benign Het
Zc3h4 T C 7: 16,429,273 Y533H unknown Het
Zfp81 A G 17: 33,336,724 I43T possibly damaging Het
Zfp963 A T 8: 69,743,493 Y103* probably null Het
Zfp963 A T 8: 69,743,495 Y103N probably benign Het
Zzef1 G T 11: 72,865,966 D1126Y probably damaging Het
Other mutations in Cyp4f13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Cyp4f13 APN 17 32941164 missense probably benign 0.00
IGL01835:Cyp4f13 APN 17 32930614 missense probably benign 0.39
IGL02234:Cyp4f13 APN 17 32924774 utr 3 prime probably benign
IGL02437:Cyp4f13 APN 17 32930608 missense probably benign 0.12
IGL02465:Cyp4f13 APN 17 32929136 critical splice donor site probably null
IGL02604:Cyp4f13 APN 17 32932421 missense probably benign 0.01
IGL02934:Cyp4f13 APN 17 32929871 missense probably damaging 1.00
IGL03177:Cyp4f13 APN 17 32946914 missense possibly damaging 0.88
R0117:Cyp4f13 UTSW 17 32930606 missense probably damaging 0.98
R0138:Cyp4f13 UTSW 17 32941106 missense possibly damaging 0.63
R0243:Cyp4f13 UTSW 17 32924969 splice site probably benign
R0357:Cyp4f13 UTSW 17 32932651 nonsense probably null
R1078:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R1757:Cyp4f13 UTSW 17 32929958 missense probably damaging 1.00
R1990:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R2351:Cyp4f13 UTSW 17 32925596 missense probably benign 0.01
R4704:Cyp4f13 UTSW 17 32925735 missense probably damaging 1.00
R4865:Cyp4f13 UTSW 17 32925704 missense probably damaging 1.00
R5004:Cyp4f13 UTSW 17 32925786 missense probably benign 0.39
R5310:Cyp4f13 UTSW 17 32925821 missense probably damaging 1.00
R5574:Cyp4f13 UTSW 17 32929205 missense probably benign 0.39
R5996:Cyp4f13 UTSW 17 32929473 missense possibly damaging 0.87
R6190:Cyp4f13 UTSW 17 32929873 missense probably damaging 1.00
R8254:Cyp4f13 UTSW 17 32929933 missense probably benign 0.04
R8495:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R8496:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R8498:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTGCTTCAGCATCACAGG -3'
(R):5'- TGTCATCAAGGAGAGACGCAGCAC -3'

Sequencing Primer
(F):5'- TTCAGCATCACAGGCTGGAC -3'
(R):5'- CAATACGCAGGGTGTTGAATTCC -3'
Posted On2013-05-09