Incidental Mutation 'R0220:Ccnj'
ID33820
Institutional Source Beutler Lab
Gene Symbol Ccnj
Ensembl Gene ENSMUSG00000025010
Gene Namecyclin J
Synonyms
MMRRC Submission 038469-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R0220 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location40831279-40848572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40844810 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 144 (L144P)
Ref Sequence ENSEMBL: ENSMUSP00000113712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025983] [ENSMUST00000119316] [ENSMUST00000120057]
Predicted Effect probably damaging
Transcript: ENSMUST00000025983
AA Change: L144P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025983
Gene: ENSMUSG00000025010
AA Change: L144P

DomainStartEndE-ValueType
CYCLIN 45 136 1.59e-13 SMART
Cyclin_C 145 282 7.02e-21 SMART
CYCLIN 153 248 2.1e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119316
AA Change: L144P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112643
Gene: ENSMUSG00000025010
AA Change: L144P

DomainStartEndE-ValueType
CYCLIN 45 136 1.59e-13 SMART
Cyclin_C 145 282 7.02e-21 SMART
CYCLIN 153 248 2.1e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120057
AA Change: L144P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113712
Gene: ENSMUSG00000025010
AA Change: L144P

DomainStartEndE-ValueType
CYCLIN 45 136 1.59e-13 SMART
Cyclin_C 145 270 6.99e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,148,420 probably null Het
Abcc5 A G 16: 20,369,102 V863A probably benign Het
Anxa6 A C 11: 54,981,762 probably null Het
Armc10 A G 5: 21,661,584 K296R probably benign Het
Arpc2 T A 1: 74,248,134 F38I probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bcl6 T A 16: 23,966,219 H677L possibly damaging Het
Bcl7a G A 5: 123,351,919 V49I probably damaging Het
Cdh8 G T 8: 99,111,679 P510T probably benign Het
Cgnl1 C A 9: 71,724,943 K375N possibly damaging Het
Cubn C A 2: 13,356,709 R1695L probably damaging Het
Cyp3a59 G A 5: 146,098,270 V253I probably benign Het
Cyp4f13 A G 17: 32,929,502 I208T probably damaging Het
Dennd4a A C 9: 64,852,445 E277D probably damaging Het
Depdc1a G A 3: 159,523,905 V625I probably benign Het
Dot1l A T 10: 80,785,858 D448V probably damaging Het
Efhc1 A G 1: 20,967,358 D253G probably damaging Het
Eme1 T A 11: 94,650,258 E246V probably null Het
Foxred1 A G 9: 35,209,453 L128P probably damaging Het
Gm14124 A T 2: 150,268,675 Q428H unknown Het
Gm4787 G T 12: 81,378,648 S245R probably damaging Het
Gm5141 T A 13: 62,774,457 K299N probably damaging Het
Greb1 C A 12: 16,682,286 R1558L probably damaging Het
Ip6k3 A T 17: 27,145,229 F282I probably damaging Het
Kdm2a T C 19: 4,324,919 D288G possibly damaging Het
Kdm4d A T 9: 14,463,122 V480E probably benign Het
Kif26a A T 12: 112,157,390 Q143L probably damaging Het
Klhl41 G A 2: 69,670,485 D97N probably benign Het
Krt34 C T 11: 100,038,693 probably benign Het
Lcn11 A T 2: 25,777,831 H77L probably benign Het
Megf6 G A 4: 154,258,215 R529H probably damaging Het
Mipol1 A G 12: 57,457,150 E368G probably damaging Het
Mtus1 A T 8: 40,994,572 M442K probably damaging Het
Naca T C 10: 128,043,386 probably benign Het
Nbea G A 3: 56,005,303 T1021I probably benign Het
Nfib A T 4: 82,296,776 V530E probably damaging Het
Nptx1 A G 11: 119,544,641 V283A probably damaging Het
Olfr1261 G T 2: 89,993,862 L156F probably benign Het
Olfr190 A T 16: 59,074,732 M116K probably damaging Het
Opn5 A G 17: 42,596,604 V127A probably benign Het
Pcgf6 A G 19: 47,040,090 V291A probably benign Het
Pilrb2 C A 5: 137,871,197 R47L probably benign Het
Prom2 A C 2: 127,541,107 S72A probably benign Het
Sema3e T C 5: 14,164,153 F144S possibly damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smarcc2 A T 10: 128,483,636 D798V probably benign Het
Taf5 T C 19: 47,080,560 S563P probably damaging Het
Topaz1 A G 9: 122,749,303 H426R possibly damaging Het
Tpgs1 T A 10: 79,675,437 C138S possibly damaging Het
Traf1 A T 2: 34,949,103 V70D probably benign Het
Ttn T C 2: 76,811,393 Y13453C probably damaging Het
Ubxn4 T A 1: 128,256,194 V97D possibly damaging Het
Ugt1a8 A T 1: 88,088,335 I157L probably benign Het
Vmn2r13 A T 5: 109,156,466 C700S probably damaging Het
Wee1 A T 7: 110,124,526 D216V probably benign Het
Zc3h4 T C 7: 16,429,273 Y533H unknown Het
Zfp81 A G 17: 33,336,724 I43T possibly damaging Het
Zfp963 A T 8: 69,743,493 Y103* probably null Het
Zfp963 A T 8: 69,743,495 Y103N probably benign Het
Zzef1 G T 11: 72,865,966 D1126Y probably damaging Het
Other mutations in Ccnj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01903:Ccnj APN 19 40846010 missense probably damaging 1.00
IGL02584:Ccnj APN 19 40844741 missense probably benign 0.04
R0452:Ccnj UTSW 19 40845064 intron probably null
R0693:Ccnj UTSW 19 40837107 missense probably damaging 1.00
R1600:Ccnj UTSW 19 40844657 splice site probably benign
R2237:Ccnj UTSW 19 40845775 missense probably benign 0.00
R2258:Ccnj UTSW 19 40845833 missense probably benign 0.00
R2879:Ccnj UTSW 19 40844714 missense probably damaging 1.00
R6162:Ccnj UTSW 19 40845162 missense probably damaging 1.00
R6384:Ccnj UTSW 19 40846007 missense probably benign 0.09
R6528:Ccnj UTSW 19 40832085 unclassified probably null
R6830:Ccnj UTSW 19 40845192 missense probably damaging 0.99
R7338:Ccnj UTSW 19 40837033 missense probably damaging 1.00
R7346:Ccnj UTSW 19 40844950 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCCTGCTGGAAGACCTCCAAATACC -3'
(R):5'- TTGAGTCACCATGCACAGTCACCC -3'

Sequencing Primer
(F):5'- TCCAAATACCACTCTGCTGAC -3'
(R):5'- ACCCGAGGGCACTCTCAG -3'
Posted On2013-05-09