Incidental Mutation 'R0225:Dnlz'
ID 33829
Institutional Source Beutler Lab
Gene Symbol Dnlz
Ensembl Gene ENSMUSG00000075467
Gene Name DNL-type zinc finger
Synonyms 1110034G11Rik, D2Bwg1335e
MMRRC Submission 038470-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.876) question?
Stock # R0225 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 26238133-26242122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26241380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 116 (N116S)
Ref Sequence ENSEMBL: ENSMUSP00000028295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028294] [ENSMUST00000028295] [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000100303] [ENSMUST00000114134]
AlphaFold Q9D113
Predicted Effect probably benign
Transcript: ENSMUST00000028294
SMART Domains Protein: ENSMUSP00000028294
Gene: ENSMUSG00000026928

DomainStartEndE-ValueType
Pfam:CARD 11 97 3.1e-21 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028295
AA Change: N116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028295
Gene: ENSMUSG00000075467
AA Change: N116S

DomainStartEndE-ValueType
low complexity region 38 67 N/A INTRINSIC
Pfam:zf-DNL 74 139 4.1e-34 PFAM
low complexity region 158 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066889
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066936
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078616
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100303
SMART Domains Protein: ENSMUSP00000097876
Gene: ENSMUSG00000026928

DomainStartEndE-ValueType
Pfam:CARD 11 97 7.1e-22 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125848
Predicted Effect probably benign
Transcript: ENSMUST00000145884
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114134
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Meta Mutation Damage Score 0.7848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,139,378 (GRCm39) L1470Q probably damaging Het
Abraxas2 G A 7: 132,476,584 (GRCm39) R105Q probably damaging Het
Arhgap23 G T 11: 97,335,154 (GRCm39) V70L probably benign Het
Bicd1 T C 6: 149,414,448 (GRCm39) I387T probably benign Het
Cd59b G A 2: 103,909,286 (GRCm39) probably null Het
Chn2 T C 6: 54,267,436 (GRCm39) probably benign Het
Col18a1 T C 10: 76,924,748 (GRCm39) S14G possibly damaging Het
Col5a2 A G 1: 45,446,195 (GRCm39) I461T probably benign Het
Dele1 G A 18: 38,394,317 (GRCm39) V505I probably benign Het
Esyt2 A G 12: 116,331,330 (GRCm39) N736S probably damaging Het
F11 T C 8: 45,702,114 (GRCm39) T267A probably benign Het
Fam234b T G 6: 135,194,072 (GRCm39) S242A possibly damaging Het
Gadd45b A G 10: 80,766,181 (GRCm39) N11S probably benign Het
Garnl3 T C 2: 32,896,816 (GRCm39) T608A possibly damaging Het
Gata3 T C 2: 9,879,620 (GRCm39) T119A probably benign Het
Gm10647 A G 9: 66,705,777 (GRCm39) probably benign Het
Gm10936 G A 10: 117,084,035 (GRCm39) noncoding transcript Het
Gzmd A G 14: 56,367,161 (GRCm39) W244R probably damaging Het
Hdac2 T A 10: 36,865,180 (GRCm39) D131E probably benign Het
Hira T A 16: 18,774,921 (GRCm39) F949I probably benign Het
Ighv15-2 T G 12: 114,528,657 (GRCm39) probably benign Het
Il3 A G 11: 54,156,506 (GRCm39) probably null Het
Itgae A C 11: 73,002,168 (GRCm39) M91L probably benign Het
Jkampl A G 6: 73,446,402 (GRCm39) L49P possibly damaging Het
Kat2b A G 17: 53,948,238 (GRCm39) E336G probably damaging Het
Kctd21 T A 7: 96,997,298 (GRCm39) I257N probably benign Het
Kif23 C G 9: 61,832,976 (GRCm39) probably benign Het
Lgi3 A T 14: 70,770,261 (GRCm39) I109L probably benign Het
Lhx9 A T 1: 138,766,417 (GRCm39) C124S probably damaging Het
Lipo4 A G 19: 33,479,006 (GRCm39) V278A probably benign Het
Lrch3 T A 16: 32,782,124 (GRCm39) probably benign Het
Lrp1b T C 2: 40,486,995 (GRCm39) E142G probably damaging Het
Map9 G A 3: 82,267,290 (GRCm39) probably benign Het
Miox C T 15: 89,218,657 (GRCm39) probably benign Het
Mndal A T 1: 173,685,079 (GRCm39) probably benign Het
Mug2 G T 6: 122,051,673 (GRCm39) V952L possibly damaging Het
Nepn A T 10: 52,276,533 (GRCm39) T29S probably damaging Het
Or14a260 A G 7: 85,984,803 (GRCm39) I267T probably benign Het
Or4k5 T G 14: 50,386,092 (GRCm39) K80Q probably damaging Het
Or8d1b A G 9: 38,887,574 (GRCm39) I201V probably benign Het
Or8k53 T C 2: 86,178,072 (GRCm39) I13V possibly damaging Het
Phf3 A T 1: 30,844,146 (GRCm39) D1604E probably benign Het
Plekhn1 T C 4: 156,312,700 (GRCm39) R53G probably benign Het
Prickle1 A G 15: 93,408,658 (GRCm39) L47P possibly damaging Het
Ptar1 T A 19: 23,695,459 (GRCm39) C309S probably benign Het
Rapgef2 A T 3: 79,011,412 (GRCm39) S224R probably damaging Het
Rimoc1 T C 15: 4,015,776 (GRCm39) K263E probably damaging Het
Siglecg G A 7: 43,060,595 (GRCm39) G325D probably damaging Het
Skor2 A T 18: 76,946,793 (GRCm39) I172F unknown Het
Slc9a1 A G 4: 133,147,916 (GRCm39) K645E probably benign Het
St14 T A 9: 31,019,580 (GRCm39) probably null Het
Tas2r120 T A 6: 132,634,552 (GRCm39) Y211* probably null Het
Tbxa2r C A 10: 81,168,734 (GRCm39) T141K possibly damaging Het
Tpd52l1 A G 10: 31,255,252 (GRCm39) S32P probably damaging Het
Ttn T A 2: 76,540,468 (GRCm39) R34173W probably damaging Het
Ttn C A 2: 76,623,474 (GRCm39) V15368L possibly damaging Het
Tyms A G 5: 30,268,256 (GRCm39) I148T probably damaging Het
Vmn1r45 A T 6: 89,910,492 (GRCm39) Y159* probably null Het
Vmn1r58 A C 7: 5,413,865 (GRCm39) S122A probably benign Het
Vmn2r13 C A 5: 109,322,915 (GRCm39) V125L probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Vps13b T C 15: 35,887,407 (GRCm39) I3272T probably benign Het
Wfdc8 A G 2: 164,439,105 (GRCm39) Y426H probably benign Het
Zfp948 A T 17: 21,807,556 (GRCm39) K249N probably damaging Het
Zfyve1 A G 12: 83,601,847 (GRCm39) probably benign Het
Zyg11a G A 4: 108,061,838 (GRCm39) T321I probably damaging Het
Other mutations in Dnlz
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0123:Dnlz UTSW 2 26,241,380 (GRCm39) missense probably damaging 1.00
R0134:Dnlz UTSW 2 26,241,380 (GRCm39) missense probably damaging 1.00
R0799:Dnlz UTSW 2 26,241,485 (GRCm39) missense possibly damaging 0.91
R2273:Dnlz UTSW 2 26,241,483 (GRCm39) missense probably damaging 1.00
R2274:Dnlz UTSW 2 26,241,483 (GRCm39) missense probably damaging 1.00
R2275:Dnlz UTSW 2 26,241,483 (GRCm39) missense probably damaging 1.00
R5750:Dnlz UTSW 2 26,241,423 (GRCm39) missense probably damaging 1.00
X0026:Dnlz UTSW 2 26,240,566 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCCACTGATCCCTCCTCATAGAAC -3'
(R):5'- AGAGACTTTCCTGTGTATGCCTTGC -3'

Sequencing Primer
(F):5'- CACTAGAGATTGATAAGGCCCCTG -3'
(R):5'- GTGTATGCCTTGCCTGACC -3'
Posted On 2013-05-09