Mutagenetix > Incidental Mutation

Incidental Mutation 'R0225:Chn2'

33844

Institutional Source

Beutler Lab

Gene Symbol

Chn2

Ensembl Gene

ENSMUSG00000004633

Gene Name

chimerin 2

Synonyms

4930557O16Rik, 1700026N20Rik

MMRRC Submission

038470-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R0225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54039554-54301810 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 54290451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046856] [ENSMUST00000067741] [ENSMUST00000114401] [ENSMUST00000114402] [ENSMUST00000146114] [ENSMUST00000203091] [ENSMUST00000203941] [ENSMUST00000204115] [ENSMUST00000204746] [ENSMUST00000204921]

AlphaFold

Q80XD1

Predicted Effect

probably benign
Transcript: ENSMUST00000046856

SMART Domains

Protein: ENSMUSP00000035908
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
SH2	57	136	7.23e-16	SMART
C1	215	264	1.88e-15	SMART
RhoGAP	288	465	2.73e-73	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067741

SMART Domains

Protein: ENSMUSP00000066078
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
C1	79	128	1.88e-15	SMART
RhoGAP	152	329	2.73e-73	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114401

SMART Domains

Protein: ENSMUSP00000110043
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
C1	24	73	1.88e-15	SMART
RhoGAP	97	274	2.73e-73	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114402

SMART Domains

Protein: ENSMUSP00000110044
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
C1	24	73	1.88e-15	SMART
RhoGAP	97	224	2.07e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145111

Predicted Effect

probably benign
Transcript: ENSMUST00000146114

SMART Domains

Protein: ENSMUSP00000114476
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
C1	29	78	1.88e-15	SMART
RhoGAP	102	279	2.73e-73	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203091

SMART Domains

Protein: ENSMUSP00000145008
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
C1	79	128	9.1e-18	SMART
Pfam:RhoGAP	155	196	5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203941

SMART Domains

Protein: ENSMUSP00000145314
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
RhoGAP	101	225	1.2e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204115

SMART Domains

Protein: ENSMUSP00000145507
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
C1	79	128	9.1e-18	SMART
RhoGAP	101	257	3.7e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204746

SMART Domains

Protein: ENSMUSP00000144983
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
RhoGAP	101	271	4.7e-61	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204921

SMART Domains

Protein: ENSMUSP00000145231
Gene: ENSMUSG00000004633

Domain	Start	End	E-Value	Type
C1	79	128	9.1e-18	SMART
RhoGAP	152	283	4.9e-37	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired infrapyramidal tract neuron prunning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
4931417E11Rik	A	G	6: 73,469,419	L49P	possibly damaging	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Abraxas2	G	A	7: 132,874,855	R105Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Col18a1	T	C	10: 77,088,914	S14G	possibly damaging	Het
Col5a2	A	G	1: 45,407,035	I461T	probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
F11	T	C	8: 45,249,077	T267A	probably benign	Het
Fam234b	T	G	6: 135,217,074	S242A	possibly damaging	Het
Gadd45b	A	G	10: 80,930,347	N11S	probably benign	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Gata3	T	C	2: 9,874,809	T119A	probably benign	Het
Gm10647	A	G	9: 66,798,495		probably benign	Het
Gm10936	G	A	10: 117,248,130		noncoding transcript	Het
Gzmd	A	G	14: 56,129,704	W244R	probably damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hira	T	A	16: 18,956,171	F949I	probably benign	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kat2b	A	G	17: 53,641,210	E336G	probably damaging	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif23	C	G	9: 61,925,694		probably benign	Het
Lgi3	A	T	14: 70,532,821	I109L	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrch3	T	A	16: 32,961,754		probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Mug2	G	T	6: 122,074,714	V952L	possibly damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Olfr729	T	G	14: 50,148,635	K80Q	probably damaging	Het
Olfr933	A	G	9: 38,976,278	I201V	probably benign	Het
Phf3	A	T	1: 30,805,065	D1604E	probably benign	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rapgef2	A	T	3: 79,104,105	S224R	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Skor2	A	T	18: 76,859,098	I172F	unknown	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
St14	T	A	9: 31,108,284		probably null	Het
Tas2r120	T	A	6: 132,657,589	Y211*	probably null	Het
Tbxa2r	C	A	10: 81,332,900	T141K	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Tyms	A	G	5: 30,063,258	I148T	probably damaging	Het
Vmn1r45	A	T	6: 89,933,510	Y159*	probably null	Het
Vmn1r58	A	C	7: 5,410,866	S122A	probably benign	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Wfdc8	A	G	2: 164,597,185	Y426H	probably benign	Het
Zfp948	A	T	17: 21,587,294	K249N	probably damaging	Het
Zfyve1	A	G	12: 83,555,073		probably benign	Het
Zyg11a	G	A	4: 108,204,641	T321I	probably damaging	Het

Other mutations in Chn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Chn2	APN	6	54295922	critical splice donor site	probably null
IGL02158:Chn2	APN	6	54300245	unclassified	probably benign
IGL02618:Chn2	APN	6	54220437	missense	probably damaging	1.00
IGL02807:Chn2	APN	6	54295913	missense	possibly damaging	0.80
IGL03357:Chn2	APN	6	54194077	missense	probably benign	0.02
R0002:Chn2	UTSW	6	54273113	missense	probably benign	0.08
R0123:Chn2	UTSW	6	54290451	splice site	probably benign
R1478:Chn2	UTSW	6	54293080	missense	probably damaging	1.00
R1905:Chn2	UTSW	6	54286121	missense	probably damaging	1.00
R3769:Chn2	UTSW	6	54290411	missense	probably damaging	1.00
R3946:Chn2	UTSW	6	54269426	unclassified	probably benign
R4125:Chn2	UTSW	6	54272978	missense	probably damaging	1.00
R4127:Chn2	UTSW	6	54272978	missense	probably damaging	1.00
R4128:Chn2	UTSW	6	54272978	missense	probably damaging	1.00
R4614:Chn2	UTSW	6	54290403	missense	probably damaging	1.00
R4616:Chn2	UTSW	6	54290403	missense	probably damaging	1.00
R5063:Chn2	UTSW	6	54290287	nonsense	probably null
R5121:Chn2	UTSW	6	54218561	missense	possibly damaging	0.57
R5208:Chn2	UTSW	6	54295801	missense	probably damaging	0.97
R5240:Chn2	UTSW	6	54220695	missense	probably benign
R5348:Chn2	UTSW	6	54300218	missense	probably damaging	0.99
R5861:Chn2	UTSW	6	54290374	missense	probably damaging	1.00
R6539:Chn2	UTSW	6	54173461	splice site	probably null
R6824:Chn2	UTSW	6	54272953	missense	probably benign	0.00
R7194:Chn2	UTSW	6	54286177	splice site	probably null
R7740:Chn2	UTSW	6	54300171	missense	probably benign	0.18
R7765:Chn2	UTSW	6	54298152	critical splice donor site	probably null
R7997:Chn2	UTSW	6	54290285	missense	probably damaging	1.00
R8477:Chn2	UTSW	6	54269482	splice site	probably null
R8804:Chn2	UTSW	6	54273076	missense	probably benign	0.01
R9297:Chn2	UTSW	6	54295855	missense	probably damaging	1.00
R9318:Chn2	UTSW	6	54295855	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGGGACCCAGTGACGCTAATG -3'
(R):5'- ACTCCCCGAATGAGTCTCCAGTATG -3'

Sequencing Primer
(F):5'- CACAGATTGTGGGTTAAACGTACAC -3'
(R):5'- tcagatcattgctctctagcc -3'

Posted On

2013-05-09