Mutagenetix > Incidental Mutations

Incidental Mutation 'R0225:Bicd1'

33850

Institutional Source

Beutler Lab

Gene Symbol

Bicd1

Ensembl Gene

ENSMUSG00000003452

Gene Name

BICD cargo adaptor 1

Synonyms

B830009D06Rik

MMRRC Submission

038470-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0225 (G1)

Quality Score

197

Status

Validated

Chromosome

Chromosomal Location

149408886-149563329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 149512950 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 387 (I387T)

Ref Sequence

ENSEMBL: ENSMUSP00000133727 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]

Predicted Effect

probably benign
Transcript: ENSMUST00000003544
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: I387T

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086829
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: I387T

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111513
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: I387T

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	822	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172926

SMART Domains

Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452

Domain	Start	End	E-Value	Type
Pfam:BicD	1	98	1.2e-69	PFAM
low complexity region	103	120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173408
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: I387T

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174886

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
4931417E11Rik	A	G	6: 73,469,419	L49P	possibly damaging	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Abraxas2	G	A	7: 132,874,855	R105Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Chn2	T	C	6: 54,290,451		probably benign	Het
Col18a1	T	C	10: 77,088,914	S14G	possibly damaging	Het
Col5a2	A	G	1: 45,407,035	I461T	probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
F11	T	C	8: 45,249,077	T267A	probably benign	Het
Fam234b	T	G	6: 135,217,074	S242A	possibly damaging	Het
Gadd45b	A	G	10: 80,930,347	N11S	probably benign	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Gata3	T	C	2: 9,874,809	T119A	probably benign	Het
Gm10647	A	G	9: 66,798,495		probably benign	Het
Gm10936	G	A	10: 117,248,130		noncoding transcript	Het
Gzmd	A	G	14: 56,129,704	W244R	probably damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hira	T	A	16: 18,956,171	F949I	probably benign	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kat2b	A	G	17: 53,641,210	E336G	probably damaging	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif23	C	G	9: 61,925,694		probably benign	Het
Lgi3	A	T	14: 70,532,821	I109L	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrch3	T	A	16: 32,961,754		probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Mug2	G	T	6: 122,074,714	V952L	possibly damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Olfr729	T	G	14: 50,148,635	K80Q	probably damaging	Het
Olfr933	A	G	9: 38,976,278	I201V	probably benign	Het
Phf3	A	T	1: 30,805,065	D1604E	probably benign	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rapgef2	A	T	3: 79,104,105	S224R	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Skor2	A	T	18: 76,859,098	I172F	unknown	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
St14	T	A	9: 31,108,284		probably null	Het
Tas2r120	T	A	6: 132,657,589	Y211*	probably null	Het
Tbxa2r	C	A	10: 81,332,900	T141K	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Tyms	A	G	5: 30,063,258	I148T	probably damaging	Het
Vmn1r45	A	T	6: 89,933,510	Y159*	probably null	Het
Vmn1r58	A	C	7: 5,410,866	S122A	probably benign	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Wfdc8	A	G	2: 164,597,185	Y426H	probably benign	Het
Zfp948	A	T	17: 21,587,294	K249N	probably damaging	Het
Zfyve1	A	G	12: 83,555,073		probably benign	Het
Zyg11a	G	A	4: 108,204,641	T321I	probably damaging	Het

Other mutations in Bicd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Bicd1	APN	6	149550390	missense	possibly damaging	0.72
IGL02489:Bicd1	APN	6	149513037	missense	probably damaging	1.00
IGL02626:Bicd1	APN	6	149409556	missense	probably damaging	1.00
IGL02966:Bicd1	APN	6	149483996	missense	probably damaging	0.99
IGL03256:Bicd1	APN	6	149513585	missense	probably benign
R0123:Bicd1	UTSW	6	149512950	missense	probably benign	0.00
R0131:Bicd1	UTSW	6	149512947	missense	probably damaging	0.99
R0134:Bicd1	UTSW	6	149512950	missense	probably benign	0.00
R0267:Bicd1	UTSW	6	149517042	missense	probably damaging	1.00
R0481:Bicd1	UTSW	6	149511891	missense	possibly damaging	0.90
R0560:Bicd1	UTSW	6	149511962	missense	probably benign	0.34
R0729:Bicd1	UTSW	6	149512914	missense	probably damaging	0.97
R0784:Bicd1	UTSW	6	149513363	missense	probably damaging	0.98
R1994:Bicd1	UTSW	6	149513552	missense	probably benign	0.00
R2221:Bicd1	UTSW	6	149517005	missense	probably damaging	0.98
R2762:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R3428:Bicd1	UTSW	6	149512902	missense	probably damaging	1.00
R3805:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R3806:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R3807:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R4694:Bicd1	UTSW	6	149409553	missense	probably damaging	1.00
R4822:Bicd1	UTSW	6	149519254	intron	probably benign
R4835:Bicd1	UTSW	6	149484090	missense	probably benign	0.00
R5157:Bicd1	UTSW	6	149520414	missense	probably benign	0.09
R5527:Bicd1	UTSW	6	149494636	missense	probably damaging	1.00
R5611:Bicd1	UTSW	6	149513456	nonsense	probably null
R5643:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R5644:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R5788:Bicd1	UTSW	6	149484000	missense	probably benign	0.39
R5898:Bicd1	UTSW	6	149513703	missense	probably damaging	0.99
R6222:Bicd1	UTSW	6	149512965	missense	probably damaging	1.00
R6227:Bicd1	UTSW	6	149513176	nonsense	probably null
R6522:Bicd1	UTSW	6	149484005	missense	probably benign
R6781:Bicd1	UTSW	6	149513166	missense	possibly damaging	0.86
R6812:Bicd1	UTSW	6	149409537	missense	probably damaging	1.00
R7010:Bicd1	UTSW	6	149494615	missense	probably damaging	1.00
R7203:Bicd1	UTSW	6	149512905	missense	possibly damaging	0.91
R7265:Bicd1	UTSW	6	149513876	missense	probably damaging	1.00
R7362:Bicd1	UTSW	6	149484093	missense	probably benign	0.13
R7526:Bicd1	UTSW	6	149513726	missense	possibly damaging	0.46
R7545:Bicd1	UTSW	6	149513492	missense	probably benign
R7581:Bicd1	UTSW	6	149519004	missense	probably damaging	1.00
R7589:Bicd1	UTSW	6	149513667	missense	possibly damaging	0.61
R7639:Bicd1	UTSW	6	149513004	missense	possibly damaging	0.92
R7715:Bicd1	UTSW	6	149512973	missense	probably benign	0.11
R8188:Bicd1	UTSW	6	149550356	missense	probably damaging	0.98
R8271:Bicd1	UTSW	6	149513135	missense	probably benign	0.00
R8338:Bicd1	UTSW	6	149513123	missense	probably benign	0.00
R8375:Bicd1	UTSW	6	149520491	missense	probably benign
R8770:Bicd1	UTSW	6	149518950	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTTTTCCCTGAAGTGATTCAGAC -3'
(R):5'- GGCTATGCCAGTCATCTTTTGCAAC -3'

Sequencing Primer
(F):5'- ATTCAGACATTGTCTTCTGTCATTAC -3'
(R):5'- GATGTCTTCTCAAGGTTTGTCAC -3'

Posted On

2013-05-09