Incidental Mutation 'R0225:Siglecg'
ID 33852
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Name sialic acid binding Ig-like lectin G
Synonyms A630096C01Rik, mSiglec-G
MMRRC Submission 038470-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R0225 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43057623-43067773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43060595 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 325 (G325D)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
AlphaFold Q80ZE3
Predicted Effect probably damaging
Transcript: ENSMUST00000005592
AA Change: G325D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: G325D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154322
Meta Mutation Damage Score 0.9143 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,139,378 (GRCm39) L1470Q probably damaging Het
Abraxas2 G A 7: 132,476,584 (GRCm39) R105Q probably damaging Het
Arhgap23 G T 11: 97,335,154 (GRCm39) V70L probably benign Het
Bicd1 T C 6: 149,414,448 (GRCm39) I387T probably benign Het
Cd59b G A 2: 103,909,286 (GRCm39) probably null Het
Chn2 T C 6: 54,267,436 (GRCm39) probably benign Het
Col18a1 T C 10: 76,924,748 (GRCm39) S14G possibly damaging Het
Col5a2 A G 1: 45,446,195 (GRCm39) I461T probably benign Het
Dele1 G A 18: 38,394,317 (GRCm39) V505I probably benign Het
Dnlz T C 2: 26,241,380 (GRCm39) N116S probably damaging Het
Esyt2 A G 12: 116,331,330 (GRCm39) N736S probably damaging Het
F11 T C 8: 45,702,114 (GRCm39) T267A probably benign Het
Fam234b T G 6: 135,194,072 (GRCm39) S242A possibly damaging Het
Gadd45b A G 10: 80,766,181 (GRCm39) N11S probably benign Het
Garnl3 T C 2: 32,896,816 (GRCm39) T608A possibly damaging Het
Gata3 T C 2: 9,879,620 (GRCm39) T119A probably benign Het
Gm10647 A G 9: 66,705,777 (GRCm39) probably benign Het
Gm10936 G A 10: 117,084,035 (GRCm39) noncoding transcript Het
Gzmd A G 14: 56,367,161 (GRCm39) W244R probably damaging Het
Hdac2 T A 10: 36,865,180 (GRCm39) D131E probably benign Het
Hira T A 16: 18,774,921 (GRCm39) F949I probably benign Het
Ighv15-2 T G 12: 114,528,657 (GRCm39) probably benign Het
Il3 A G 11: 54,156,506 (GRCm39) probably null Het
Itgae A C 11: 73,002,168 (GRCm39) M91L probably benign Het
Jkampl A G 6: 73,446,402 (GRCm39) L49P possibly damaging Het
Kat2b A G 17: 53,948,238 (GRCm39) E336G probably damaging Het
Kctd21 T A 7: 96,997,298 (GRCm39) I257N probably benign Het
Kif23 C G 9: 61,832,976 (GRCm39) probably benign Het
Lgi3 A T 14: 70,770,261 (GRCm39) I109L probably benign Het
Lhx9 A T 1: 138,766,417 (GRCm39) C124S probably damaging Het
Lipo4 A G 19: 33,479,006 (GRCm39) V278A probably benign Het
Lrch3 T A 16: 32,782,124 (GRCm39) probably benign Het
Lrp1b T C 2: 40,486,995 (GRCm39) E142G probably damaging Het
Map9 G A 3: 82,267,290 (GRCm39) probably benign Het
Miox C T 15: 89,218,657 (GRCm39) probably benign Het
Mndal A T 1: 173,685,079 (GRCm39) probably benign Het
Mug2 G T 6: 122,051,673 (GRCm39) V952L possibly damaging Het
Nepn A T 10: 52,276,533 (GRCm39) T29S probably damaging Het
Or14a260 A G 7: 85,984,803 (GRCm39) I267T probably benign Het
Or4k5 T G 14: 50,386,092 (GRCm39) K80Q probably damaging Het
Or8d1b A G 9: 38,887,574 (GRCm39) I201V probably benign Het
Or8k53 T C 2: 86,178,072 (GRCm39) I13V possibly damaging Het
Phf3 A T 1: 30,844,146 (GRCm39) D1604E probably benign Het
Plekhn1 T C 4: 156,312,700 (GRCm39) R53G probably benign Het
Prickle1 A G 15: 93,408,658 (GRCm39) L47P possibly damaging Het
Ptar1 T A 19: 23,695,459 (GRCm39) C309S probably benign Het
Rapgef2 A T 3: 79,011,412 (GRCm39) S224R probably damaging Het
Rimoc1 T C 15: 4,015,776 (GRCm39) K263E probably damaging Het
Skor2 A T 18: 76,946,793 (GRCm39) I172F unknown Het
Slc9a1 A G 4: 133,147,916 (GRCm39) K645E probably benign Het
St14 T A 9: 31,019,580 (GRCm39) probably null Het
Tas2r120 T A 6: 132,634,552 (GRCm39) Y211* probably null Het
Tbxa2r C A 10: 81,168,734 (GRCm39) T141K possibly damaging Het
Tpd52l1 A G 10: 31,255,252 (GRCm39) S32P probably damaging Het
Ttn T A 2: 76,540,468 (GRCm39) R34173W probably damaging Het
Ttn C A 2: 76,623,474 (GRCm39) V15368L possibly damaging Het
Tyms A G 5: 30,268,256 (GRCm39) I148T probably damaging Het
Vmn1r45 A T 6: 89,910,492 (GRCm39) Y159* probably null Het
Vmn1r58 A C 7: 5,413,865 (GRCm39) S122A probably benign Het
Vmn2r13 C A 5: 109,322,915 (GRCm39) V125L probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Vps13b T C 15: 35,887,407 (GRCm39) I3272T probably benign Het
Wfdc8 A G 2: 164,439,105 (GRCm39) Y426H probably benign Het
Zfp948 A T 17: 21,807,556 (GRCm39) K249N probably damaging Het
Zfyve1 A G 12: 83,601,847 (GRCm39) probably benign Het
Zyg11a G A 4: 108,061,838 (GRCm39) T321I probably damaging Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43,058,481 (GRCm39) missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43,061,219 (GRCm39) missense probably benign 0.02
IGL01806:Siglecg APN 7 43,060,888 (GRCm39) splice site probably null
IGL01947:Siglecg APN 7 43,058,187 (GRCm39) missense probably benign 0.43
IGL02257:Siglecg APN 7 43,061,328 (GRCm39) missense probably benign 0.00
IGL02410:Siglecg APN 7 43,058,253 (GRCm39) missense probably damaging 0.99
IGL02454:Siglecg APN 7 43,058,319 (GRCm39) missense probably benign 0.00
Chamonix UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
Dollywood UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
glowworm UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
Montblanc UTSW 7 43,060,810 (GRCm39) intron probably benign
Shenandoah UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
shenandoah2 UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
Sherando UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
Smokies UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 1.00
R0134:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0480:Siglecg UTSW 7 43,060,550 (GRCm39) missense probably benign 0.42
R1538:Siglecg UTSW 7 43,067,313 (GRCm39) missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43,058,365 (GRCm39) missense probably benign 0.17
R2358:Siglecg UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43,067,332 (GRCm39) missense probably benign 0.03
R4754:Siglecg UTSW 7 43,061,295 (GRCm39) intron probably benign
R5017:Siglecg UTSW 7 43,060,810 (GRCm39) intron probably benign
R5713:Siglecg UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
R5777:Siglecg UTSW 7 43,058,837 (GRCm39) missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43,061,628 (GRCm39) intron probably benign
R6153:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43,058,178 (GRCm39) missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43,058,403 (GRCm39) missense probably benign 0.00
R7066:Siglecg UTSW 7 43,061,166 (GRCm39) missense probably benign 0.40
R7884:Siglecg UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
R8275:Siglecg UTSW 7 43,061,892 (GRCm39) missense probably benign
R8554:Siglecg UTSW 7 43,058,320 (GRCm39) missense probably benign 0.01
R8846:Siglecg UTSW 7 43,061,942 (GRCm39) missense probably benign 0.02
R8873:Siglecg UTSW 7 43,067,448 (GRCm39) missense probably benign 0.00
R8887:Siglecg UTSW 7 43,058,008 (GRCm39) missense probably benign 0.18
R9012:Siglecg UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
R9032:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9048:Siglecg UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
R9085:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9313:Siglecg UTSW 7 43,061,856 (GRCm39) missense probably benign 0.03
R9320:Siglecg UTSW 7 43,058,853 (GRCm39) missense probably benign 0.33
R9745:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 0.98
RF006:Siglecg UTSW 7 43,058,288 (GRCm39) nonsense probably null
Z1177:Siglecg UTSW 7 43,061,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCAGCAAGGCCAGTCTCTTC -3'
(R):5'- GAAACAGTCACTCTCAGGTCCTGTG -3'

Sequencing Primer
(F):5'- GGCCAGTCTCTTCGCCTC -3'
(R):5'- TCTCCCTGGGCAGAACATC -3'
Posted On 2013-05-09