Incidental Mutation 'R0225:Abraxas2'
Institutional Source Beutler Lab
Gene Symbol Abraxas2
Ensembl Gene ENSMUSG00000030965
Gene NameBRISC complex subunit
SynonymsC430003P19Rik, Fam175b, KIAA0157
MMRRC Submission 038470-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0225 (G1)
Quality Score225
Status Validated
Chromosomal Location132859225-132885111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132874855 bp
Amino Acid Change Arginine to Glutamine at position 105 (R105Q)
Ref Sequence ENSEMBL: ENSMUSP00000101767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084497] [ENSMUST00000106161] [ENSMUST00000124096] [ENSMUST00000134784]
Predicted Effect probably damaging
Transcript: ENSMUST00000084497
AA Change: R108Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081541
Gene: ENSMUSG00000030965
AA Change: R108Q

coiled coil region 224 276 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106161
AA Change: R105Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101767
Gene: ENSMUSG00000030965
AA Change: R105Q

coiled coil region 221 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129552
AA Change: R103Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect silent
Transcript: ENSMUST00000134784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144225
Predicted Effect probably benign
Transcript: ENSMUST00000147786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211184
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Col18a1 T C 10: 77,088,914 S14G possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
F11 T C 8: 45,249,077 T267A probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Gadd45b A G 10: 80,930,347 N11S probably benign Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Gm10647 A G 9: 66,798,495 probably benign Het
Gm10936 G A 10: 117,248,130 noncoding transcript Het
Gzmd A G 14: 56,129,704 W244R probably damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kat2b A G 17: 53,641,210 E336G probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif23 C G 9: 61,925,694 probably benign Het
Lgi3 A T 14: 70,532,821 I109L probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Olfr729 T G 14: 50,148,635 K80Q probably damaging Het
Olfr933 A G 9: 38,976,278 I201V probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rapgef2 A T 3: 79,104,105 S224R probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Skor2 A T 18: 76,859,098 I172F unknown Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
St14 T A 9: 31,108,284 probably null Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tbxa2r C A 10: 81,332,900 T141K possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Tyms A G 5: 30,063,258 I148T probably damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn1r58 A C 7: 5,410,866 S122A probably benign Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Wfdc8 A G 2: 164,597,185 Y426H probably benign Het
Zfp948 A T 17: 21,587,294 K249N probably damaging Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zyg11a G A 4: 108,204,641 T321I probably damaging Het
Other mutations in Abraxas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Abraxas2 APN 7 132883428 missense probably benign 0.00
R0123:Abraxas2 UTSW 7 132874855 missense probably damaging 1.00
R0670:Abraxas2 UTSW 7 132869031 critical splice acceptor site probably null
R2145:Abraxas2 UTSW 7 132883061 missense probably benign 0.27
R2244:Abraxas2 UTSW 7 132883211 missense probably benign 0.00
R3839:Abraxas2 UTSW 7 132883138 missense probably benign 0.03
R5133:Abraxas2 UTSW 7 132883146 missense probably benign 0.01
R5260:Abraxas2 UTSW 7 132859274 missense probably damaging 1.00
R6217:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6305:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6312:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6313:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6793:Abraxas2 UTSW 7 132874834 missense probably damaging 1.00
R7350:Abraxas2 UTSW 7 132874849 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ccttaccagccctgCATACTTGATTT -3'

Sequencing Primer
(F):5'- catctattttccacaccctacaac -3'
Posted On2013-05-09