Incidental Mutation 'R0225:F11'
ID33857
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Namecoagulation factor XI
SynonymsFXI, plasma thromboplastin antecedent, Cf11, 1600027G01Rik
MMRRC Submission 038470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0225 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45241174-45262031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45249077 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
Predicted Effect probably benign
Transcript: ENSMUST00000034064
AA Change: T267A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: T267A

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210622
Meta Mutation Damage Score 0.0801 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Col18a1 T C 10: 77,088,914 S14G possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Gadd45b A G 10: 80,930,347 N11S probably benign Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Gm10647 A G 9: 66,798,495 probably benign Het
Gm10936 G A 10: 117,248,130 noncoding transcript Het
Gzmd A G 14: 56,129,704 W244R probably damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kat2b A G 17: 53,641,210 E336G probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif23 C G 9: 61,925,694 probably benign Het
Lgi3 A T 14: 70,532,821 I109L probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Olfr729 T G 14: 50,148,635 K80Q probably damaging Het
Olfr933 A G 9: 38,976,278 I201V probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rapgef2 A T 3: 79,104,105 S224R probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Skor2 A T 18: 76,859,098 I172F unknown Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
St14 T A 9: 31,108,284 probably null Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tbxa2r C A 10: 81,332,900 T141K possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Tyms A G 5: 30,063,258 I148T probably damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn1r58 A C 7: 5,410,866 S122A probably benign Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Wfdc8 A G 2: 164,597,185 Y426H probably benign Het
Zfp948 A T 17: 21,587,294 K249N probably damaging Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zyg11a G A 4: 108,204,641 T321I probably damaging Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45250095 missense probably damaging 1.00
IGL02096:F11 APN 8 45246754 missense probably benign 0.05
IGL02363:F11 APN 8 45241531 missense probably damaging 1.00
IGL02694:F11 APN 8 45252159 missense probably damaging 1.00
IGL03374:F11 APN 8 45261074 missense possibly damaging 0.63
R0525:F11 UTSW 8 45253049 missense probably benign 0.01
R0842:F11 UTSW 8 45252159 missense probably damaging 1.00
R0961:F11 UTSW 8 45241494 missense probably damaging 1.00
R1605:F11 UTSW 8 45241580 missense probably damaging 1.00
R2044:F11 UTSW 8 45252118 missense probably benign 0.03
R2113:F11 UTSW 8 45246832 missense probably benign 0.00
R2273:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2274:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2275:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2318:F11 UTSW 8 45248638 missense probably damaging 1.00
R2319:F11 UTSW 8 45248638 missense probably damaging 1.00
R2403:F11 UTSW 8 45248638 missense probably damaging 1.00
R2510:F11 UTSW 8 45248638 missense probably damaging 1.00
R2512:F11 UTSW 8 45261061 missense probably benign 0.01
R2893:F11 UTSW 8 45248638 missense probably damaging 1.00
R2894:F11 UTSW 8 45248638 missense probably damaging 1.00
R2910:F11 UTSW 8 45241449 makesense probably null
R3030:F11 UTSW 8 45248638 missense probably damaging 1.00
R3105:F11 UTSW 8 45245717 missense probably damaging 0.97
R3721:F11 UTSW 8 45248638 missense probably damaging 1.00
R3726:F11 UTSW 8 45248638 missense probably damaging 1.00
R3906:F11 UTSW 8 45248638 missense probably damaging 1.00
R3909:F11 UTSW 8 45248638 missense probably damaging 1.00
R4465:F11 UTSW 8 45241474 missense probably damaging 1.00
R4467:F11 UTSW 8 45241474 missense probably damaging 1.00
R4710:F11 UTSW 8 45250146 missense probably damaging 1.00
R4824:F11 UTSW 8 45255342 missense probably damaging 0.99
R4968:F11 UTSW 8 45245733 missense probably benign 0.19
R5225:F11 UTSW 8 45255304 missense probably benign 0.09
R5288:F11 UTSW 8 45246796 missense probably damaging 1.00
R5378:F11 UTSW 8 45252143 missense probably benign 0.19
R6155:F11 UTSW 8 45252082 missense probably damaging 1.00
R6213:F11 UTSW 8 45241500 missense probably damaging 1.00
R6615:F11 UTSW 8 45248774 missense probably benign
R6797:F11 UTSW 8 45253055 missense probably benign 0.02
R7147:F11 UTSW 8 45250146 missense probably damaging 1.00
R7683:F11 UTSW 8 45249508 missense probably damaging 0.97
R7688:F11 UTSW 8 45250090 missense probably damaging 1.00
R7720:F11 UTSW 8 45252090 missense possibly damaging 0.89
R8064:F11 UTSW 8 45245773 missense probably benign 0.01
U24488:F11 UTSW 8 45242312 missense probably benign 0.04
Z1088:F11 UTSW 8 45245772 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AAGAGCATCCACCTAACTTGTGCC -3'
(R):5'- CGCGACTTGGTGATTCAAGAAGC -3'

Sequencing Primer
(F):5'- TTCTCCCAAGAAATCAGTGTCG -3'
(R):5'- TTGGTGATTCAAGAAGCAATGTTAGG -3'
Posted On2013-05-09