Incidental Mutation 'R0225:Kif23'
ID33860
Institutional Source Beutler Lab
Gene Symbol Kif23
Ensembl Gene ENSMUSG00000032254
Gene Namekinesin family member 23
SynonymsMKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1
MMRRC Submission 038470-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0225 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location61915905-61946774 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to G at 61925694 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]
Predicted Effect probably benign
Transcript: ENSMUST00000034815
SMART Domains Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254

DomainStartEndE-ValueType
KISc 23 444 6.56e-147 SMART
Blast:KISc 524 607 8e-20 BLAST
low complexity region 661 678 N/A INTRINSIC
low complexity region 681 693 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
Pfam:MKLP1_Arf_bdg 796 899 9.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213595
Predicted Effect probably benign
Transcript: ENSMUST00000214295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216812
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Col18a1 T C 10: 77,088,914 S14G possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
F11 T C 8: 45,249,077 T267A probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Gadd45b A G 10: 80,930,347 N11S probably benign Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Gm10647 A G 9: 66,798,495 probably benign Het
Gm10936 G A 10: 117,248,130 noncoding transcript Het
Gzmd A G 14: 56,129,704 W244R probably damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kat2b A G 17: 53,641,210 E336G probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Lgi3 A T 14: 70,532,821 I109L probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Olfr729 T G 14: 50,148,635 K80Q probably damaging Het
Olfr933 A G 9: 38,976,278 I201V probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rapgef2 A T 3: 79,104,105 S224R probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Skor2 A T 18: 76,859,098 I172F unknown Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
St14 T A 9: 31,108,284 probably null Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tbxa2r C A 10: 81,332,900 T141K possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Tyms A G 5: 30,063,258 I148T probably damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn1r58 A C 7: 5,410,866 S122A probably benign Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Wfdc8 A G 2: 164,597,185 Y426H probably benign Het
Zfp948 A T 17: 21,587,294 K249N probably damaging Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zyg11a G A 4: 108,204,641 T321I probably damaging Het
Other mutations in Kif23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Kif23 APN 9 61926468 missense probably benign 0.19
IGL00814:Kif23 APN 9 61937107 missense possibly damaging 0.95
IGL01295:Kif23 APN 9 61932129 missense possibly damaging 0.89
IGL01521:Kif23 APN 9 61919900 missense probably damaging 0.99
IGL01583:Kif23 APN 9 61935468 missense probably damaging 1.00
IGL01680:Kif23 APN 9 61931814 missense probably benign 0.17
IGL02450:Kif23 APN 9 61923957 missense probably benign 0.00
IGL02698:Kif23 APN 9 61925001 missense possibly damaging 0.49
IGL03152:Kif23 APN 9 61929776 splice site probably benign
IGL03233:Kif23 APN 9 61926453 missense probably benign 0.05
H8562:Kif23 UTSW 9 61924065 missense probably benign
R0419:Kif23 UTSW 9 61926405 nonsense probably null
R0512:Kif23 UTSW 9 61918975 splice site probably benign
R0731:Kif23 UTSW 9 61925032 missense possibly damaging 0.67
R0980:Kif23 UTSW 9 61936764 missense possibly damaging 0.93
R1315:Kif23 UTSW 9 61923988 unclassified probably null
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1451:Kif23 UTSW 9 61924802 missense probably damaging 1.00
R1624:Kif23 UTSW 9 61925700 splice site probably null
R1820:Kif23 UTSW 9 61926438 missense possibly damaging 0.67
R1867:Kif23 UTSW 9 61918961 missense possibly damaging 0.87
R1937:Kif23 UTSW 9 61946610 critical splice donor site probably null
R2001:Kif23 UTSW 9 61927384 nonsense probably null
R2002:Kif23 UTSW 9 61927384 nonsense probably null
R2310:Kif23 UTSW 9 61924144 missense probably damaging 1.00
R2680:Kif23 UTSW 9 61937476 missense probably benign 0.25
R3196:Kif23 UTSW 9 61931911 nonsense probably null
R3774:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3775:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3776:Kif23 UTSW 9 61924992 missense probably benign 0.00
R4349:Kif23 UTSW 9 61932114 missense probably damaging 1.00
R4671:Kif23 UTSW 9 61945359 missense probably benign 0.04
R4981:Kif23 UTSW 9 61931871 missense probably damaging 1.00
R4983:Kif23 UTSW 9 61936703 missense probably benign 0.01
R5685:Kif23 UTSW 9 61945409 missense probably benign 0.12
R5721:Kif23 UTSW 9 61944216 missense probably benign 0.45
R6903:Kif23 UTSW 9 61927154 missense possibly damaging 0.77
R7067:Kif23 UTSW 9 61924989 missense probably benign 0.01
R7103:Kif23 UTSW 9 61919892 missense probably damaging 0.99
R7456:Kif23 UTSW 9 61937120 missense probably benign 0.09
R7468:Kif23 UTSW 9 61937175 nonsense probably null
Z1177:Kif23 UTSW 9 61924163 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCTGAGAGCACTGCCGAACATC -3'
(R):5'- GCCAGGGTCTTCAGCTAAGTTCAAC -3'

Sequencing Primer
(F):5'- GAAGTATGACCGCAAACCTTG -3'
(R):5'- AGAATACGTCTGTGAACCTCTC -3'
Posted On2013-05-09