Incidental Mutation 'R0225:Kif23'
ID 33860
Institutional Source Beutler Lab
Gene Symbol Kif23
Ensembl Gene ENSMUSG00000032254
Gene Name kinesin family member 23
Synonyms Knsl5, CHO1, C87313, MKLP-1, 3110001D19Rik, MKLP1
MMRRC Submission 038470-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R0225 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 61824559-61854078 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 61832976 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]
AlphaFold E9Q5G3
Predicted Effect probably benign
Transcript: ENSMUST00000034815
SMART Domains Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254

DomainStartEndE-ValueType
KISc 23 444 6.56e-147 SMART
Blast:KISc 524 607 8e-20 BLAST
low complexity region 661 678 N/A INTRINSIC
low complexity region 681 693 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
Pfam:MKLP1_Arf_bdg 796 899 9.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213595
Predicted Effect probably benign
Transcript: ENSMUST00000214295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216812
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,139,378 (GRCm39) L1470Q probably damaging Het
Abraxas2 G A 7: 132,476,584 (GRCm39) R105Q probably damaging Het
Arhgap23 G T 11: 97,335,154 (GRCm39) V70L probably benign Het
Bicd1 T C 6: 149,414,448 (GRCm39) I387T probably benign Het
Cd59b G A 2: 103,909,286 (GRCm39) probably null Het
Chn2 T C 6: 54,267,436 (GRCm39) probably benign Het
Col18a1 T C 10: 76,924,748 (GRCm39) S14G possibly damaging Het
Col5a2 A G 1: 45,446,195 (GRCm39) I461T probably benign Het
Dele1 G A 18: 38,394,317 (GRCm39) V505I probably benign Het
Dnlz T C 2: 26,241,380 (GRCm39) N116S probably damaging Het
Esyt2 A G 12: 116,331,330 (GRCm39) N736S probably damaging Het
F11 T C 8: 45,702,114 (GRCm39) T267A probably benign Het
Fam234b T G 6: 135,194,072 (GRCm39) S242A possibly damaging Het
Gadd45b A G 10: 80,766,181 (GRCm39) N11S probably benign Het
Garnl3 T C 2: 32,896,816 (GRCm39) T608A possibly damaging Het
Gata3 T C 2: 9,879,620 (GRCm39) T119A probably benign Het
Gm10647 A G 9: 66,705,777 (GRCm39) probably benign Het
Gm10936 G A 10: 117,084,035 (GRCm39) noncoding transcript Het
Gzmd A G 14: 56,367,161 (GRCm39) W244R probably damaging Het
Hdac2 T A 10: 36,865,180 (GRCm39) D131E probably benign Het
Hira T A 16: 18,774,921 (GRCm39) F949I probably benign Het
Ighv15-2 T G 12: 114,528,657 (GRCm39) probably benign Het
Il3 A G 11: 54,156,506 (GRCm39) probably null Het
Itgae A C 11: 73,002,168 (GRCm39) M91L probably benign Het
Jkampl A G 6: 73,446,402 (GRCm39) L49P possibly damaging Het
Kat2b A G 17: 53,948,238 (GRCm39) E336G probably damaging Het
Kctd21 T A 7: 96,997,298 (GRCm39) I257N probably benign Het
Lgi3 A T 14: 70,770,261 (GRCm39) I109L probably benign Het
Lhx9 A T 1: 138,766,417 (GRCm39) C124S probably damaging Het
Lipo4 A G 19: 33,479,006 (GRCm39) V278A probably benign Het
Lrch3 T A 16: 32,782,124 (GRCm39) probably benign Het
Lrp1b T C 2: 40,486,995 (GRCm39) E142G probably damaging Het
Map9 G A 3: 82,267,290 (GRCm39) probably benign Het
Miox C T 15: 89,218,657 (GRCm39) probably benign Het
Mndal A T 1: 173,685,079 (GRCm39) probably benign Het
Mug2 G T 6: 122,051,673 (GRCm39) V952L possibly damaging Het
Nepn A T 10: 52,276,533 (GRCm39) T29S probably damaging Het
Or14a260 A G 7: 85,984,803 (GRCm39) I267T probably benign Het
Or4k5 T G 14: 50,386,092 (GRCm39) K80Q probably damaging Het
Or8d1b A G 9: 38,887,574 (GRCm39) I201V probably benign Het
Or8k53 T C 2: 86,178,072 (GRCm39) I13V possibly damaging Het
Phf3 A T 1: 30,844,146 (GRCm39) D1604E probably benign Het
Plekhn1 T C 4: 156,312,700 (GRCm39) R53G probably benign Het
Prickle1 A G 15: 93,408,658 (GRCm39) L47P possibly damaging Het
Ptar1 T A 19: 23,695,459 (GRCm39) C309S probably benign Het
Rapgef2 A T 3: 79,011,412 (GRCm39) S224R probably damaging Het
Rimoc1 T C 15: 4,015,776 (GRCm39) K263E probably damaging Het
Siglecg G A 7: 43,060,595 (GRCm39) G325D probably damaging Het
Skor2 A T 18: 76,946,793 (GRCm39) I172F unknown Het
Slc9a1 A G 4: 133,147,916 (GRCm39) K645E probably benign Het
St14 T A 9: 31,019,580 (GRCm39) probably null Het
Tas2r120 T A 6: 132,634,552 (GRCm39) Y211* probably null Het
Tbxa2r C A 10: 81,168,734 (GRCm39) T141K possibly damaging Het
Tpd52l1 A G 10: 31,255,252 (GRCm39) S32P probably damaging Het
Ttn T A 2: 76,540,468 (GRCm39) R34173W probably damaging Het
Ttn C A 2: 76,623,474 (GRCm39) V15368L possibly damaging Het
Tyms A G 5: 30,268,256 (GRCm39) I148T probably damaging Het
Vmn1r45 A T 6: 89,910,492 (GRCm39) Y159* probably null Het
Vmn1r58 A C 7: 5,413,865 (GRCm39) S122A probably benign Het
Vmn2r13 C A 5: 109,322,915 (GRCm39) V125L probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Vps13b T C 15: 35,887,407 (GRCm39) I3272T probably benign Het
Wfdc8 A G 2: 164,439,105 (GRCm39) Y426H probably benign Het
Zfp948 A T 17: 21,807,556 (GRCm39) K249N probably damaging Het
Zfyve1 A G 12: 83,601,847 (GRCm39) probably benign Het
Zyg11a G A 4: 108,061,838 (GRCm39) T321I probably damaging Het
Other mutations in Kif23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Kif23 APN 9 61,833,750 (GRCm39) missense probably benign 0.19
IGL00814:Kif23 APN 9 61,844,389 (GRCm39) missense possibly damaging 0.95
IGL01295:Kif23 APN 9 61,839,411 (GRCm39) missense possibly damaging 0.89
IGL01521:Kif23 APN 9 61,827,182 (GRCm39) missense probably damaging 0.99
IGL01583:Kif23 APN 9 61,842,750 (GRCm39) missense probably damaging 1.00
IGL01680:Kif23 APN 9 61,839,096 (GRCm39) missense probably benign 0.17
IGL02450:Kif23 APN 9 61,831,239 (GRCm39) missense probably benign 0.00
IGL02698:Kif23 APN 9 61,832,283 (GRCm39) missense possibly damaging 0.49
IGL03152:Kif23 APN 9 61,837,058 (GRCm39) splice site probably benign
IGL03233:Kif23 APN 9 61,833,735 (GRCm39) missense probably benign 0.05
H8562:Kif23 UTSW 9 61,831,347 (GRCm39) missense probably benign
R0419:Kif23 UTSW 9 61,833,687 (GRCm39) nonsense probably null
R0512:Kif23 UTSW 9 61,826,257 (GRCm39) splice site probably benign
R0731:Kif23 UTSW 9 61,832,314 (GRCm39) missense possibly damaging 0.67
R0980:Kif23 UTSW 9 61,844,046 (GRCm39) missense possibly damaging 0.93
R1315:Kif23 UTSW 9 61,831,270 (GRCm39) splice site probably null
R1347:Kif23 UTSW 9 61,834,438 (GRCm39) missense probably damaging 0.99
R1347:Kif23 UTSW 9 61,834,438 (GRCm39) missense probably damaging 0.99
R1451:Kif23 UTSW 9 61,832,084 (GRCm39) missense probably damaging 1.00
R1624:Kif23 UTSW 9 61,832,982 (GRCm39) splice site probably null
R1820:Kif23 UTSW 9 61,833,720 (GRCm39) missense possibly damaging 0.67
R1867:Kif23 UTSW 9 61,826,243 (GRCm39) missense possibly damaging 0.87
R1937:Kif23 UTSW 9 61,853,892 (GRCm39) critical splice donor site probably null
R2001:Kif23 UTSW 9 61,834,666 (GRCm39) nonsense probably null
R2002:Kif23 UTSW 9 61,834,666 (GRCm39) nonsense probably null
R2310:Kif23 UTSW 9 61,831,426 (GRCm39) missense probably damaging 1.00
R2680:Kif23 UTSW 9 61,844,758 (GRCm39) missense probably benign 0.25
R3196:Kif23 UTSW 9 61,839,193 (GRCm39) nonsense probably null
R3774:Kif23 UTSW 9 61,832,274 (GRCm39) missense probably benign 0.00
R3775:Kif23 UTSW 9 61,832,274 (GRCm39) missense probably benign 0.00
R3776:Kif23 UTSW 9 61,832,274 (GRCm39) missense probably benign 0.00
R4349:Kif23 UTSW 9 61,839,396 (GRCm39) missense probably damaging 1.00
R4671:Kif23 UTSW 9 61,852,641 (GRCm39) missense probably benign 0.04
R4981:Kif23 UTSW 9 61,839,153 (GRCm39) missense probably damaging 1.00
R4983:Kif23 UTSW 9 61,843,985 (GRCm39) missense probably benign 0.01
R5685:Kif23 UTSW 9 61,852,691 (GRCm39) missense probably benign 0.12
R5721:Kif23 UTSW 9 61,851,498 (GRCm39) missense probably benign 0.45
R6903:Kif23 UTSW 9 61,834,436 (GRCm39) missense possibly damaging 0.77
R7067:Kif23 UTSW 9 61,832,271 (GRCm39) missense probably benign 0.01
R7103:Kif23 UTSW 9 61,827,174 (GRCm39) missense probably damaging 0.99
R7456:Kif23 UTSW 9 61,844,402 (GRCm39) missense probably benign 0.09
R7468:Kif23 UTSW 9 61,844,457 (GRCm39) nonsense probably null
R8357:Kif23 UTSW 9 61,834,317 (GRCm39) critical splice donor site probably null
R8457:Kif23 UTSW 9 61,834,317 (GRCm39) critical splice donor site probably null
R8716:Kif23 UTSW 9 61,844,477 (GRCm39) missense probably damaging 1.00
R8783:Kif23 UTSW 9 61,834,853 (GRCm39) missense probably benign 0.00
R9028:Kif23 UTSW 9 61,828,341 (GRCm39) missense probably damaging 0.99
R9137:Kif23 UTSW 9 61,834,713 (GRCm39) missense probably damaging 0.97
R9283:Kif23 UTSW 9 61,852,651 (GRCm39) missense probably benign
R9430:Kif23 UTSW 9 61,834,722 (GRCm39) missense probably damaging 1.00
R9457:Kif23 UTSW 9 61,851,507 (GRCm39) missense probably benign 0.02
R9533:Kif23 UTSW 9 61,832,924 (GRCm39) missense probably benign
Z1177:Kif23 UTSW 9 61,831,445 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCTGAGAGCACTGCCGAACATC -3'
(R):5'- GCCAGGGTCTTCAGCTAAGTTCAAC -3'

Sequencing Primer
(F):5'- GAAGTATGACCGCAAACCTTG -3'
(R):5'- AGAATACGTCTGTGAACCTCTC -3'
Posted On 2013-05-09