Mutagenetix > Incidental Mutation

Incidental Mutation 'R0225:Kif23'

33860

Institutional Source

Beutler Lab

Gene Symbol

Kif23

Ensembl Gene

ENSMUSG00000032254

Gene Name

kinesin family member 23

Synonyms

MKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1

MMRRC Submission

038470-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R0225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61915905-61946774 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to G at 61925694 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149553 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]

AlphaFold

E9Q5G3

Predicted Effect

probably benign
Transcript: ENSMUST00000034815

SMART Domains

Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254

Domain	Start	End	E-Value	Type
KISc	23	444	6.56e-147	SMART
Blast:KISc	524	607	8e-20	BLAST
low complexity region	661	678	N/A	INTRINSIC
low complexity region	681	693	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
Pfam:MKLP1_Arf_bdg	796	899	9.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213595

Predicted Effect

probably benign
Transcript: ENSMUST00000214295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214940

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215319

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215965

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216746

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216812

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
4931417E11Rik	A	G	6: 73,469,419	L49P	possibly damaging	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Abraxas2	G	A	7: 132,874,855	R105Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Chn2	T	C	6: 54,290,451		probably benign	Het
Col18a1	T	C	10: 77,088,914	S14G	possibly damaging	Het
Col5a2	A	G	1: 45,407,035	I461T	probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
F11	T	C	8: 45,249,077	T267A	probably benign	Het
Fam234b	T	G	6: 135,217,074	S242A	possibly damaging	Het
Gadd45b	A	G	10: 80,930,347	N11S	probably benign	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Gata3	T	C	2: 9,874,809	T119A	probably benign	Het
Gm10647	A	G	9: 66,798,495		probably benign	Het
Gm10936	G	A	10: 117,248,130		noncoding transcript	Het
Gzmd	A	G	14: 56,129,704	W244R	probably damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hira	T	A	16: 18,956,171	F949I	probably benign	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kat2b	A	G	17: 53,641,210	E336G	probably damaging	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Lgi3	A	T	14: 70,532,821	I109L	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrch3	T	A	16: 32,961,754		probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Mug2	G	T	6: 122,074,714	V952L	possibly damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Olfr729	T	G	14: 50,148,635	K80Q	probably damaging	Het
Olfr933	A	G	9: 38,976,278	I201V	probably benign	Het
Phf3	A	T	1: 30,805,065	D1604E	probably benign	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rapgef2	A	T	3: 79,104,105	S224R	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Skor2	A	T	18: 76,859,098	I172F	unknown	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
St14	T	A	9: 31,108,284		probably null	Het
Tas2r120	T	A	6: 132,657,589	Y211*	probably null	Het
Tbxa2r	C	A	10: 81,332,900	T141K	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Tyms	A	G	5: 30,063,258	I148T	probably damaging	Het
Vmn1r45	A	T	6: 89,933,510	Y159*	probably null	Het
Vmn1r58	A	C	7: 5,410,866	S122A	probably benign	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Wfdc8	A	G	2: 164,597,185	Y426H	probably benign	Het
Zfp948	A	T	17: 21,587,294	K249N	probably damaging	Het
Zfyve1	A	G	12: 83,555,073		probably benign	Het
Zyg11a	G	A	4: 108,204,641	T321I	probably damaging	Het

Other mutations in Kif23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Kif23	APN	9	61926468	missense	probably benign	0.19
IGL00814:Kif23	APN	9	61937107	missense	possibly damaging	0.95
IGL01295:Kif23	APN	9	61932129	missense	possibly damaging	0.89
IGL01521:Kif23	APN	9	61919900	missense	probably damaging	0.99
IGL01583:Kif23	APN	9	61935468	missense	probably damaging	1.00
IGL01680:Kif23	APN	9	61931814	missense	probably benign	0.17
IGL02450:Kif23	APN	9	61923957	missense	probably benign	0.00
IGL02698:Kif23	APN	9	61925001	missense	possibly damaging	0.49
IGL03152:Kif23	APN	9	61929776	splice site	probably benign
IGL03233:Kif23	APN	9	61926453	missense	probably benign	0.05
H8562:Kif23	UTSW	9	61924065	missense	probably benign
R0419:Kif23	UTSW	9	61926405	nonsense	probably null
R0512:Kif23	UTSW	9	61918975	splice site	probably benign
R0731:Kif23	UTSW	9	61925032	missense	possibly damaging	0.67
R0980:Kif23	UTSW	9	61936764	missense	possibly damaging	0.93
R1315:Kif23	UTSW	9	61923988	splice site	probably null
R1347:Kif23	UTSW	9	61927156	missense	probably damaging	0.99
R1347:Kif23	UTSW	9	61927156	missense	probably damaging	0.99
R1451:Kif23	UTSW	9	61924802	missense	probably damaging	1.00
R1624:Kif23	UTSW	9	61925700	splice site	probably null
R1820:Kif23	UTSW	9	61926438	missense	possibly damaging	0.67
R1867:Kif23	UTSW	9	61918961	missense	possibly damaging	0.87
R1937:Kif23	UTSW	9	61946610	critical splice donor site	probably null
R2001:Kif23	UTSW	9	61927384	nonsense	probably null
R2002:Kif23	UTSW	9	61927384	nonsense	probably null
R2310:Kif23	UTSW	9	61924144	missense	probably damaging	1.00
R2680:Kif23	UTSW	9	61937476	missense	probably benign	0.25
R3196:Kif23	UTSW	9	61931911	nonsense	probably null
R3774:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R3775:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R3776:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R4349:Kif23	UTSW	9	61932114	missense	probably damaging	1.00
R4671:Kif23	UTSW	9	61945359	missense	probably benign	0.04
R4981:Kif23	UTSW	9	61931871	missense	probably damaging	1.00
R4983:Kif23	UTSW	9	61936703	missense	probably benign	0.01
R5685:Kif23	UTSW	9	61945409	missense	probably benign	0.12
R5721:Kif23	UTSW	9	61944216	missense	probably benign	0.45
R6903:Kif23	UTSW	9	61927154	missense	possibly damaging	0.77
R7067:Kif23	UTSW	9	61924989	missense	probably benign	0.01
R7103:Kif23	UTSW	9	61919892	missense	probably damaging	0.99
R7456:Kif23	UTSW	9	61937120	missense	probably benign	0.09
R7468:Kif23	UTSW	9	61937175	nonsense	probably null
R8357:Kif23	UTSW	9	61927035	critical splice donor site	probably null
R8457:Kif23	UTSW	9	61927035	critical splice donor site	probably null
R8716:Kif23	UTSW	9	61937195	missense	probably damaging	1.00
R8783:Kif23	UTSW	9	61927571	missense	probably benign	0.00
R9028:Kif23	UTSW	9	61921059	missense	probably damaging	0.99
R9137:Kif23	UTSW	9	61927431	missense	probably damaging	0.97
R9283:Kif23	UTSW	9	61945369	missense	probably benign
R9430:Kif23	UTSW	9	61927440	missense	probably damaging	1.00
R9457:Kif23	UTSW	9	61944225	missense	probably benign	0.02
R9533:Kif23	UTSW	9	61925642	missense	probably benign
Z1177:Kif23	UTSW	9	61924163	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TTCTGAGAGCACTGCCGAACATC -3'
(R):5'- GCCAGGGTCTTCAGCTAAGTTCAAC -3'

Sequencing Primer
(F):5'- GAAGTATGACCGCAAACCTTG -3'
(R):5'- AGAATACGTCTGTGAACCTCTC -3'

Posted On

2013-05-09