Incidental Mutation 'R0225:Itgae'
ID 33870
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms CD103, alpha-E1
MMRRC Submission 038470-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0225 (G1)
Quality Score 125
Status Validated
Chromosome 11
Chromosomal Location 73090583-73147446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 73111342 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 91 (M91L)
Ref Sequence ENSEMBL: ENSMUSP00000099596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
AlphaFold Q60677
Predicted Effect probably benign
Transcript: ENSMUST00000006101
AA Change: M91L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: M91L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102537
AA Change: M91L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: M91L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Col18a1 T C 10: 77,088,914 S14G possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
F11 T C 8: 45,249,077 T267A probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Gadd45b A G 10: 80,930,347 N11S probably benign Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Gm10647 A G 9: 66,798,495 probably benign Het
Gm10936 G A 10: 117,248,130 noncoding transcript Het
Gzmd A G 14: 56,129,704 W244R probably damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Kat2b A G 17: 53,641,210 E336G probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif23 C G 9: 61,925,694 probably benign Het
Lgi3 A T 14: 70,532,821 I109L probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Olfr729 T G 14: 50,148,635 K80Q probably damaging Het
Olfr933 A G 9: 38,976,278 I201V probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rapgef2 A T 3: 79,104,105 S224R probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Skor2 A T 18: 76,859,098 I172F unknown Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
St14 T A 9: 31,108,284 probably null Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tbxa2r C A 10: 81,332,900 T141K possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Tyms A G 5: 30,063,258 I148T probably damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn1r58 A C 7: 5,410,866 S122A probably benign Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Wfdc8 A G 2: 164,597,185 Y426H probably benign Het
Zfp948 A T 17: 21,587,294 K249N probably damaging Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zyg11a G A 4: 108,204,641 T321I probably damaging Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73,145,635 (GRCm38) missense probably benign 0.17
IGL00472:Itgae APN 11 73,113,694 (GRCm38) missense probably benign 0.06
IGL00821:Itgae APN 11 73,123,148 (GRCm38) missense probably damaging 1.00
IGL01625:Itgae APN 11 73,119,437 (GRCm38) missense probably benign 0.00
IGL01639:Itgae APN 11 73,119,378 (GRCm38) missense probably benign 0.00
IGL01743:Itgae APN 11 73,111,759 (GRCm38) missense probably benign 0.02
IGL01911:Itgae APN 11 73,116,137 (GRCm38) missense probably damaging 1.00
IGL01949:Itgae APN 11 73,118,184 (GRCm38) missense probably benign 0.29
IGL02149:Itgae APN 11 73,103,894 (GRCm38) missense probably benign 0.04
IGL02179:Itgae APN 11 73,134,018 (GRCm38) missense probably benign 0.06
IGL02231:Itgae APN 11 73,090,622 (GRCm38) missense possibly damaging 0.88
IGL02292:Itgae APN 11 73,118,535 (GRCm38) missense probably damaging 0.98
IGL02378:Itgae APN 11 73,118,121 (GRCm38) missense probably benign 0.00
IGL02525:Itgae APN 11 73,130,951 (GRCm38) missense probably damaging 0.98
IGL02576:Itgae APN 11 73,118,505 (GRCm38) missense possibly damaging 0.95
IGL02729:Itgae APN 11 73,118,203 (GRCm38) splice site probably benign
IGL02859:Itgae APN 11 73,114,867 (GRCm38) missense probably damaging 1.00
IGL03074:Itgae APN 11 73,125,310 (GRCm38) missense probably benign 0.00
IGL03107:Itgae APN 11 73,113,601 (GRCm38) missense probably damaging 1.00
IGL03264:Itgae APN 11 73,115,574 (GRCm38) missense possibly damaging 0.73
IGL03272:Itgae APN 11 73,133,854 (GRCm38) splice site probably null
IGL03352:Itgae APN 11 73,131,730 (GRCm38) missense probably damaging 1.00
R0134:Itgae UTSW 11 73,111,342 (GRCm38) missense probably benign 0.00
R0320:Itgae UTSW 11 73,130,999 (GRCm38) missense possibly damaging 0.74
R0344:Itgae UTSW 11 73,118,147 (GRCm38) missense probably benign 0.13
R0403:Itgae UTSW 11 73,123,183 (GRCm38) missense possibly damaging 0.89
R0631:Itgae UTSW 11 73,114,907 (GRCm38) missense probably damaging 1.00
R0833:Itgae UTSW 11 73,129,206 (GRCm38) missense probably benign 0.02
R0836:Itgae UTSW 11 73,129,206 (GRCm38) missense probably benign 0.02
R0973:Itgae UTSW 11 73,138,509 (GRCm38) nonsense probably null
R1231:Itgae UTSW 11 73,119,379 (GRCm38) missense probably benign 0.02
R1389:Itgae UTSW 11 73,125,362 (GRCm38) missense probably damaging 1.00
R1433:Itgae UTSW 11 73,115,592 (GRCm38) missense probably damaging 1.00
R1534:Itgae UTSW 11 73,145,605 (GRCm38) missense possibly damaging 0.58
R1833:Itgae UTSW 11 73,117,162 (GRCm38) missense possibly damaging 0.94
R1914:Itgae UTSW 11 73,118,643 (GRCm38) splice site probably benign
R1915:Itgae UTSW 11 73,118,643 (GRCm38) splice site probably benign
R2061:Itgae UTSW 11 73,118,622 (GRCm38) missense probably benign 0.00
R2380:Itgae UTSW 11 73,145,569 (GRCm38) missense probably benign 0.00
R2435:Itgae UTSW 11 73,121,937 (GRCm38) nonsense probably null
R2680:Itgae UTSW 11 73,114,926 (GRCm38) missense probably damaging 1.00
R2886:Itgae UTSW 11 73,140,687 (GRCm38) missense probably benign 0.04
R3873:Itgae UTSW 11 73,113,616 (GRCm38) missense probably damaging 1.00
R3923:Itgae UTSW 11 73,116,143 (GRCm38) missense probably damaging 0.99
R4010:Itgae UTSW 11 73,111,339 (GRCm38) missense probably benign 0.00
R4059:Itgae UTSW 11 73,112,134 (GRCm38) missense probably benign
R4212:Itgae UTSW 11 73,119,352 (GRCm38) missense probably benign
R4213:Itgae UTSW 11 73,119,352 (GRCm38) missense probably benign
R4691:Itgae UTSW 11 73,119,519 (GRCm38) nonsense probably null
R4736:Itgae UTSW 11 73,114,880 (GRCm38) missense possibly damaging 0.79
R5152:Itgae UTSW 11 73,130,995 (GRCm38) missense probably damaging 1.00
R5201:Itgae UTSW 11 73,110,556 (GRCm38) missense probably benign 0.00
R5307:Itgae UTSW 11 73,145,638 (GRCm38) missense probably benign 0.00
R5362:Itgae UTSW 11 73,111,849 (GRCm38) missense probably damaging 1.00
R5448:Itgae UTSW 11 73,133,908 (GRCm38) critical splice donor site probably null
R5645:Itgae UTSW 11 73,129,248 (GRCm38) missense probably damaging 1.00
R5672:Itgae UTSW 11 73,145,551 (GRCm38) missense possibly damaging 0.96
R6079:Itgae UTSW 11 73,115,574 (GRCm38) missense possibly damaging 0.73
R6138:Itgae UTSW 11 73,115,574 (GRCm38) missense possibly damaging 0.73
R6226:Itgae UTSW 11 73,140,757 (GRCm38) missense probably benign 0.11
R6244:Itgae UTSW 11 73,145,601 (GRCm38) missense probably damaging 0.96
R6326:Itgae UTSW 11 73,131,693 (GRCm38) missense possibly damaging 0.88
R6332:Itgae UTSW 11 73,111,402 (GRCm38) splice site probably null
R6502:Itgae UTSW 11 73,145,592 (GRCm38) missense probably benign 0.10
R6825:Itgae UTSW 11 73,118,496 (GRCm38) missense possibly damaging 0.89
R7016:Itgae UTSW 11 73,119,516 (GRCm38) missense probably damaging 0.99
R7020:Itgae UTSW 11 73,111,369 (GRCm38) missense probably damaging 1.00
R7069:Itgae UTSW 11 73,116,143 (GRCm38) missense probably damaging 0.99
R7132:Itgae UTSW 11 73,111,358 (GRCm38) missense possibly damaging 0.93
R7473:Itgae UTSW 11 73,140,678 (GRCm38) missense possibly damaging 0.87
R7599:Itgae UTSW 11 73,121,960 (GRCm38) missense possibly damaging 0.62
R7637:Itgae UTSW 11 73,113,631 (GRCm38) missense probably damaging 1.00
R7763:Itgae UTSW 11 73,123,269 (GRCm38) critical splice donor site probably null
R7829:Itgae UTSW 11 73,138,792 (GRCm38) missense probably benign
R7860:Itgae UTSW 11 73,120,273 (GRCm38) critical splice acceptor site probably null
R7978:Itgae UTSW 11 73,134,087 (GRCm38) missense probably damaging 0.98
R8197:Itgae UTSW 11 73,120,384 (GRCm38) missense probably benign
R8911:Itgae UTSW 11 73,113,621 (GRCm38) missense probably damaging 1.00
R9155:Itgae UTSW 11 73,125,263 (GRCm38) missense possibly damaging 0.94
R9284:Itgae UTSW 11 73,121,926 (GRCm38) missense probably benign 0.25
R9355:Itgae UTSW 11 73,116,080 (GRCm38) missense probably damaging 1.00
R9414:Itgae UTSW 11 73,111,803 (GRCm38) missense possibly damaging 0.59
R9595:Itgae UTSW 11 73,125,356 (GRCm38) missense probably damaging 0.99
R9618:Itgae UTSW 11 73,120,345 (GRCm38) missense possibly damaging 0.78
U15987:Itgae UTSW 11 73,115,574 (GRCm38) missense possibly damaging 0.73
X0024:Itgae UTSW 11 73,111,376 (GRCm38) missense probably benign 0.01
Z1186:Itgae UTSW 11 73,121,931 (GRCm38) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,118,087 (GRCm38) missense probably benign 0.01
Z1186:Itgae UTSW 11 73,103,960 (GRCm38) missense probably damaging 1.00
Z1186:Itgae UTSW 11 73,134,127 (GRCm38) missense probably benign 0.36
Z1186:Itgae UTSW 11 73,103,887 (GRCm38) missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73,121,957 (GRCm38) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,115,640 (GRCm38) missense probably benign
Z1187:Itgae UTSW 11 73,121,931 (GRCm38) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,134,127 (GRCm38) missense probably benign 0.36
Z1187:Itgae UTSW 11 73,103,887 (GRCm38) missense possibly damaging 0.74
Z1187:Itgae UTSW 11 73,121,957 (GRCm38) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,115,640 (GRCm38) missense probably benign
Z1187:Itgae UTSW 11 73,103,960 (GRCm38) missense probably damaging 1.00
Z1187:Itgae UTSW 11 73,118,087 (GRCm38) missense probably benign 0.01
Z1188:Itgae UTSW 11 73,121,957 (GRCm38) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,115,640 (GRCm38) missense probably benign
Z1188:Itgae UTSW 11 73,134,127 (GRCm38) missense probably benign 0.36
Z1188:Itgae UTSW 11 73,103,887 (GRCm38) missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73,103,960 (GRCm38) missense probably damaging 1.00
Z1188:Itgae UTSW 11 73,121,931 (GRCm38) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,118,087 (GRCm38) missense probably benign 0.01
Z1189:Itgae UTSW 11 73,121,957 (GRCm38) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,115,640 (GRCm38) missense probably benign
Z1189:Itgae UTSW 11 73,103,887 (GRCm38) missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73,134,127 (GRCm38) missense probably benign 0.36
Z1189:Itgae UTSW 11 73,103,960 (GRCm38) missense probably damaging 1.00
Z1189:Itgae UTSW 11 73,118,087 (GRCm38) missense probably benign 0.01
Z1189:Itgae UTSW 11 73,121,931 (GRCm38) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,115,640 (GRCm38) missense probably benign
Z1190:Itgae UTSW 11 73,103,887 (GRCm38) missense possibly damaging 0.74
Z1190:Itgae UTSW 11 73,121,957 (GRCm38) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,134,127 (GRCm38) missense probably benign 0.36
Z1190:Itgae UTSW 11 73,121,931 (GRCm38) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,103,960 (GRCm38) missense probably damaging 1.00
Z1190:Itgae UTSW 11 73,118,087 (GRCm38) missense probably benign 0.01
Z1191:Itgae UTSW 11 73,115,640 (GRCm38) missense probably benign
Z1191:Itgae UTSW 11 73,121,957 (GRCm38) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,103,887 (GRCm38) missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73,134,127 (GRCm38) missense probably benign 0.36
Z1191:Itgae UTSW 11 73,103,960 (GRCm38) missense probably damaging 1.00
Z1191:Itgae UTSW 11 73,118,087 (GRCm38) missense probably benign 0.01
Z1191:Itgae UTSW 11 73,121,931 (GRCm38) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,121,957 (GRCm38) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,115,640 (GRCm38) missense probably benign
Z1192:Itgae UTSW 11 73,134,127 (GRCm38) missense probably benign 0.36
Z1192:Itgae UTSW 11 73,103,887 (GRCm38) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,103,960 (GRCm38) missense probably damaging 1.00
Z1192:Itgae UTSW 11 73,121,931 (GRCm38) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,118,087 (GRCm38) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCAGTCATTTCTGAATCCCCATC -3'
(R):5'- AGGCTTGGCAGCTCCATAGTCATC -3'

Sequencing Primer
(F):5'- ATCCCTGGTTGTCAAGGC -3'
(R):5'- AGCTCCATAGTCATCCCCAG -3'
Posted On 2013-05-09