Mutagenetix > Incidental Mutations

Incidental Mutation 'R0225:Arhgap23'

33871

Institutional Source

Beutler Lab

Gene Symbol

Arhgap23

Ensembl Gene

ENSMUSG00000049807

Gene Name

Rho GTPase activating protein 23

Synonyms

MMRRC Submission

038470-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0225 (G1)

Quality Score

150

Status

Validated

Chromosome

Chromosomal Location

97415533-97502402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 97444328 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 70 (V70L)

Ref Sequence

ENSEMBL: ENSMUSP00000112999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121799]

Predicted Effect

probably benign
Transcript: ENSMUST00000121799
AA Change: V70L

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: V70L

Domain	Start	End	E-Value	Type
low complexity region	8	29	N/A	INTRINSIC
PDZ	52	160	4.2e-17	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	565	580	N/A	INTRINSIC
low complexity region	637	654	N/A	INTRINSIC
PH	690	811	3.2e-12	SMART
low complexity region	890	898	N/A	INTRINSIC
RhoGAP	918	1095	6.83e-65	SMART
low complexity region	1262	1277	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
low complexity region	1336	1357	N/A	INTRINSIC
low complexity region	1387	1405	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152933

Meta Mutation Damage Score

0.0712

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
4931417E11Rik	A	G	6: 73,469,419	L49P	possibly damaging	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Abraxas2	G	A	7: 132,874,855	R105Q	probably damaging	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Chn2	T	C	6: 54,290,451		probably benign	Het
Col18a1	T	C	10: 77,088,914	S14G	possibly damaging	Het
Col5a2	A	G	1: 45,407,035	I461T	probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
F11	T	C	8: 45,249,077	T267A	probably benign	Het
Fam234b	T	G	6: 135,217,074	S242A	possibly damaging	Het
Gadd45b	A	G	10: 80,930,347	N11S	probably benign	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Gata3	T	C	2: 9,874,809	T119A	probably benign	Het
Gm10647	A	G	9: 66,798,495		probably benign	Het
Gm10936	G	A	10: 117,248,130		noncoding transcript	Het
Gzmd	A	G	14: 56,129,704	W244R	probably damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hira	T	A	16: 18,956,171	F949I	probably benign	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kat2b	A	G	17: 53,641,210	E336G	probably damaging	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif23	C	G	9: 61,925,694		probably benign	Het
Lgi3	A	T	14: 70,532,821	I109L	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrch3	T	A	16: 32,961,754		probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Mug2	G	T	6: 122,074,714	V952L	possibly damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Olfr729	T	G	14: 50,148,635	K80Q	probably damaging	Het
Olfr933	A	G	9: 38,976,278	I201V	probably benign	Het
Phf3	A	T	1: 30,805,065	D1604E	probably benign	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rapgef2	A	T	3: 79,104,105	S224R	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Skor2	A	T	18: 76,859,098	I172F	unknown	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
St14	T	A	9: 31,108,284		probably null	Het
Tas2r120	T	A	6: 132,657,589	Y211*	probably null	Het
Tbxa2r	C	A	10: 81,332,900	T141K	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Tyms	A	G	5: 30,063,258	I148T	probably damaging	Het
Vmn1r45	A	T	6: 89,933,510	Y159*	probably null	Het
Vmn1r58	A	C	7: 5,410,866	S122A	probably benign	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Wfdc8	A	G	2: 164,597,185	Y426H	probably benign	Het
Zfp948	A	T	17: 21,587,294	K249N	probably damaging	Het
Zfyve1	A	G	12: 83,555,073		probably benign	Het
Zyg11a	G	A	4: 108,204,641	T321I	probably damaging	Het

Other mutations in Arhgap23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Arhgap23	APN	11	97492671	intron	probably benign
IGL00493:Arhgap23	APN	11	97446553	critical splice donor site	probably null
IGL01729:Arhgap23	APN	11	97453961	missense	probably damaging	1.00
IGL01805:Arhgap23	APN	11	97492602	intron	probably benign
IGL02005:Arhgap23	APN	11	97491219	missense	probably damaging	0.99
IGL02026:Arhgap23	APN	11	97451581	missense	probably damaging	0.99
IGL02135:Arhgap23	APN	11	97451702	missense	probably damaging	0.97
IGL02178:Arhgap23	APN	11	97452353	missense	probably benign	0.42
IGL02226:Arhgap23	APN	11	97451600	missense	probably benign	0.07
IGL02309:Arhgap23	APN	11	97466001	splice site	probably benign
IGL02399:Arhgap23	APN	11	97491005	intron	probably benign
IGL02630:Arhgap23	APN	11	97454297	missense	probably benign	0.24
IGL02724:Arhgap23	APN	11	97491179	missense	probably damaging	0.99
IGL02740:Arhgap23	APN	11	97475017	missense	probably damaging	1.00
IGL02746:Arhgap23	APN	11	97454204	splice site	probably benign
IGL02862:Arhgap23	APN	11	97456480	missense	probably damaging	1.00
IGL03380:Arhgap23	APN	11	97452518	missense	probably damaging	1.00
R0091:Arhgap23	UTSW	11	97452244	missense	probably benign	0.44
R0134:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0305:Arhgap23	UTSW	11	97501109	missense	probably damaging	0.99
R0358:Arhgap23	UTSW	11	97463588	missense	probably damaging	1.00
R0422:Arhgap23	UTSW	11	97463652	missense	probably damaging	1.00
R0497:Arhgap23	UTSW	11	97452163	missense	probably damaging	1.00
R0580:Arhgap23	UTSW	11	97446536	frame shift	probably null
R0782:Arhgap23	UTSW	11	97500554	missense	possibly damaging	0.73
R1216:Arhgap23	UTSW	11	97492672	intron	probably benign
R1488:Arhgap23	UTSW	11	97500859	missense	possibly damaging	0.53
R1785:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R1844:Arhgap23	UTSW	11	97463408	missense	probably damaging	1.00
R1855:Arhgap23	UTSW	11	97448697	missense	probably damaging	0.99
R1977:Arhgap23	UTSW	11	97451447	missense	possibly damaging	0.95
R2064:Arhgap23	UTSW	11	97493062	missense	probably benign	0.02
R2130:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R2431:Arhgap23	UTSW	11	97452404	missense	probably benign
R2853:Arhgap23	UTSW	11	97492594	splice site	probably null
R3767:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3768:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3769:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3770:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R4209:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R4247:Arhgap23	UTSW	11	97463699	missense	probably damaging	1.00
R4997:Arhgap23	UTSW	11	97452020	missense	probably damaging	0.98
R5399:Arhgap23	UTSW	11	97500917	missense	probably damaging	0.97
R5549:Arhgap23	UTSW	11	97466568	missense	probably damaging	0.96
R5655:Arhgap23	UTSW	11	97452546	critical splice donor site	probably null
R5857:Arhgap23	UTSW	11	97451579	missense	possibly damaging	0.93
R6013:Arhgap23	UTSW	11	97500992	missense	probably damaging	0.99
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6077:Arhgap23	UTSW	11	97491232	critical splice donor site	probably null
R6151:Arhgap23	UTSW	11	97500412	missense	probably benign	0.01
R6393:Arhgap23	UTSW	11	97463672	missense	probably damaging	0.98
R6693:Arhgap23	UTSW	11	97466517	missense	probably damaging	1.00
R6752:Arhgap23	UTSW	11	97452248	missense	probably damaging	0.98
R7202:Arhgap23	UTSW	11	97451993	missense	possibly damaging	0.65
R7209:Arhgap23	UTSW	11	97476085	missense	probably damaging	1.00
R7209:Arhgap23	UTSW	11	97492447	splice site	probably null
R7320:Arhgap23	UTSW	11	97451545	missense	probably benign	0.10
R7345:Arhgap23	UTSW	11	97466478	missense	possibly damaging	0.91
R7599:Arhgap23	UTSW	11	97500343	missense	probably benign
R8229:Arhgap23	UTSW	11	97453906	missense	probably benign	0.36
R8412:Arhgap23	UTSW	11	97466028	missense	probably benign	0.02
R8460:Arhgap23	UTSW	11	97452371	missense	probably damaging	1.00
R8492:Arhgap23	UTSW	11	97475021	missense	probably damaging	1.00
R8525:Arhgap23	UTSW	11	97490084	missense	probably damaging	1.00
R8692:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R8708:Arhgap23	UTSW	11	97452412	missense	probably benign	0.06
R8749:Arhgap23	UTSW	11	97500815	missense	probably damaging	0.99
R8882:Arhgap23	UTSW	11	97465123	missense	probably benign	0.00
RF020:Arhgap23	UTSW	11	97463561	missense	probably damaging	1.00
V8831:Arhgap23	UTSW	11	97456545	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGAGGAGAGAGGCTTTCTGC -3'
(R):5'- ACAGTCACAGAGCAAGTGTCCCAG -3'

Sequencing Primer
(F):5'- GTGGACCACACACTCTCTG -3'
(R):5'- TGGCACAGCCTCCTTACAG -3'

Posted On

2013-05-09