Mutagenetix > Incidental Mutations

Incidental Mutation 'R0225:Zfyve1'

33872

Institutional Source

Beutler Lab

Gene Symbol

Zfyve1

Ensembl Gene

ENSMUSG00000042628

Gene Name

zinc finger, FYVE domain containing 1

Synonyms

MMRRC Submission

038470-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83546558-83597222 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 83555073 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048319] [ENSMUST00000221919] [ENSMUST00000222448]

Predicted Effect

probably benign
Transcript: ENSMUST00000048319

SMART Domains

Protein: ENSMUSP00000042224
Gene: ENSMUSG00000042628

Domain	Start	End	E-Value	Type
low complexity region	429	436	N/A	INTRINSIC
FYVE	590	660	8.36e-13	SMART
FYVE	707	776	1.15e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221228

Predicted Effect

probably benign
Transcript: ENSMUST00000221919

Predicted Effect

probably benign
Transcript: ENSMUST00000222448

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate-containing membranes. This protein contains two zinc-binding FYVE domains in tandem and is reported to localize to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
4931417E11Rik	A	G	6: 73,469,419	L49P	possibly damaging	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Abraxas2	G	A	7: 132,874,855	R105Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Chn2	T	C	6: 54,290,451		probably benign	Het
Col18a1	T	C	10: 77,088,914	S14G	possibly damaging	Het
Col5a2	A	G	1: 45,407,035	I461T	probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
F11	T	C	8: 45,249,077	T267A	probably benign	Het
Fam234b	T	G	6: 135,217,074	S242A	possibly damaging	Het
Gadd45b	A	G	10: 80,930,347	N11S	probably benign	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Gata3	T	C	2: 9,874,809	T119A	probably benign	Het
Gm10647	A	G	9: 66,798,495		probably benign	Het
Gm10936	G	A	10: 117,248,130		noncoding transcript	Het
Gzmd	A	G	14: 56,129,704	W244R	probably damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hira	T	A	16: 18,956,171	F949I	probably benign	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kat2b	A	G	17: 53,641,210	E336G	probably damaging	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif23	C	G	9: 61,925,694		probably benign	Het
Lgi3	A	T	14: 70,532,821	I109L	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrch3	T	A	16: 32,961,754		probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Mug2	G	T	6: 122,074,714	V952L	possibly damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Olfr729	T	G	14: 50,148,635	K80Q	probably damaging	Het
Olfr933	A	G	9: 38,976,278	I201V	probably benign	Het
Phf3	A	T	1: 30,805,065	D1604E	probably benign	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rapgef2	A	T	3: 79,104,105	S224R	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Skor2	A	T	18: 76,859,098	I172F	unknown	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
St14	T	A	9: 31,108,284		probably null	Het
Tas2r120	T	A	6: 132,657,589	Y211*	probably null	Het
Tbxa2r	C	A	10: 81,332,900	T141K	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Tyms	A	G	5: 30,063,258	I148T	probably damaging	Het
Vmn1r45	A	T	6: 89,933,510	Y159*	probably null	Het
Vmn1r58	A	C	7: 5,410,866	S122A	probably benign	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Wfdc8	A	G	2: 164,597,185	Y426H	probably benign	Het
Zfp948	A	T	17: 21,587,294	K249N	probably damaging	Het
Zyg11a	G	A	4: 108,204,641	T321I	probably damaging	Het

Other mutations in Zfyve1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Zfyve1	APN	12	83574798	missense	probably benign	0.09
IGL00475:Zfyve1	APN	12	83555711	critical splice acceptor site	probably null
IGL01291:Zfyve1	APN	12	83555005	missense	probably benign	0.04
IGL01380:Zfyve1	APN	12	83552507	missense	probably damaging	1.00
IGL02037:Zfyve1	APN	12	83547920	missense	probably damaging	1.00
IGL02184:Zfyve1	APN	12	83558693	missense	probably benign	0.29
IGL02619:Zfyve1	APN	12	83550944	unclassified	probably benign
IGL03031:Zfyve1	APN	12	83574821	missense	probably damaging	0.99
IGL03105:Zfyve1	APN	12	83558639	missense	probably damaging	1.00
sasso	UTSW	12	83575056	missense	probably damaging	1.00
ANU05:Zfyve1	UTSW	12	83555005	missense	probably benign	0.04
R0123:Zfyve1	UTSW	12	83555073	splice site	probably benign
R0468:Zfyve1	UTSW	12	83555274	splice site	probably benign
R1218:Zfyve1	UTSW	12	83548051	missense	possibly damaging	0.79
R1896:Zfyve1	UTSW	12	83555614	missense	probably damaging	0.99
R2291:Zfyve1	UTSW	12	83547931	missense	probably damaging	0.99
R4023:Zfyve1	UTSW	12	83594522	missense	probably benign
R4026:Zfyve1	UTSW	12	83594522	missense	probably benign
R4209:Zfyve1	UTSW	12	83575135	missense	probably damaging	1.00
R4211:Zfyve1	UTSW	12	83575135	missense	probably damaging	1.00
R4780:Zfyve1	UTSW	12	83558647	missense	probably damaging	1.00
R4907:Zfyve1	UTSW	12	83574872	missense	probably damaging	0.96
R4908:Zfyve1	UTSW	12	83551571	missense	probably damaging	1.00
R4998:Zfyve1	UTSW	12	83548065	missense	possibly damaging	0.69
R5076:Zfyve1	UTSW	12	83555647	missense	probably damaging	1.00
R5303:Zfyve1	UTSW	12	83575056	missense	probably damaging	1.00
R5628:Zfyve1	UTSW	12	83574889	missense	probably benign	0.00
R5739:Zfyve1	UTSW	12	83575136	missense	possibly damaging	0.61
R6007:Zfyve1	UTSW	12	83558704	missense	probably damaging	1.00
R6355:Zfyve1	UTSW	12	83594641	missense	probably benign	0.01
R6641:Zfyve1	UTSW	12	83594496	missense	probably benign
R6735:Zfyve1	UTSW	12	83594844	missense	possibly damaging	0.90
R7222:Zfyve1	UTSW	12	83555005	missense	probably benign
R7278:Zfyve1	UTSW	12	83551540	missense	probably damaging	1.00
R7464:Zfyve1	UTSW	12	83551487	missense	probably benign	0.00
R8690:Zfyve1	UTSW	12	83550907	missense	probably damaging	1.00
R8857:Zfyve1	UTSW	12	83551600	missense	probably damaging	1.00
R8948:Zfyve1	UTSW	12	83548028	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCAAGGAATGGTTCTTACTCCAGG -3'
(R):5'- GCAGAGCTTCTTCTCAGGAAACCAC -3'

Sequencing Primer
(F):5'- GGTTCTTACTCCAGGCCACAC -3'
(R):5'- CTTCTCAGGAAACCACTGTAGATGG -3'

Posted On

2013-05-09