Incidental Mutation 'R0225:Zfp948'
Institutional Source Beutler Lab
Gene Symbol Zfp948
Ensembl Gene ENSMUSG00000067931
Gene Namezinc finger protein 948
MMRRC Submission 038470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0225 (G1)
Quality Score225
Status Validated
Chromosomal Location21567046-21588697 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21587294 bp
Amino Acid Change Lysine to Asparagine at position 249 (K249N)
Ref Sequence ENSEMBL: ENSMUSP00000086166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088787]
Predicted Effect probably damaging
Transcript: ENSMUST00000088787
AA Change: K249N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086166
Gene: ENSMUSG00000067931
AA Change: K249N

KRAB 13 72 1.04e-21 SMART
low complexity region 164 173 N/A INTRINSIC
ZnF_C2H2 214 236 3.16e-3 SMART
ZnF_C2H2 242 264 9.58e-3 SMART
ZnF_C2H2 270 292 2.84e-5 SMART
ZnF_C2H2 298 320 8.22e-2 SMART
ZnF_C2H2 353 375 1.69e-3 SMART
ZnF_C2H2 381 403 9.88e-5 SMART
ZnF_C2H2 409 431 9.08e-4 SMART
ZnF_C2H2 437 459 2.2e-2 SMART
ZnF_C2H2 465 487 5.99e-4 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 5.21e-4 SMART
ZnF_C2H2 549 571 9.73e-4 SMART
ZnF_C2H2 577 599 2.43e-4 SMART
ZnF_C2H2 605 627 2.91e-2 SMART
ZnF_C2H2 633 655 4.72e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Col18a1 T C 10: 77,088,914 S14G possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
F11 T C 8: 45,249,077 T267A probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Gadd45b A G 10: 80,930,347 N11S probably benign Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Gm10647 A G 9: 66,798,495 probably benign Het
Gm10936 G A 10: 117,248,130 noncoding transcript Het
Gzmd A G 14: 56,129,704 W244R probably damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kat2b A G 17: 53,641,210 E336G probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif23 C G 9: 61,925,694 probably benign Het
Lgi3 A T 14: 70,532,821 I109L probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Olfr729 T G 14: 50,148,635 K80Q probably damaging Het
Olfr933 A G 9: 38,976,278 I201V probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rapgef2 A T 3: 79,104,105 S224R probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Skor2 A T 18: 76,859,098 I172F unknown Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
St14 T A 9: 31,108,284 probably null Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tbxa2r C A 10: 81,332,900 T141K possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Tyms A G 5: 30,063,258 I148T probably damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn1r58 A C 7: 5,410,866 S122A probably benign Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Wfdc8 A G 2: 164,597,185 Y426H probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zyg11a G A 4: 108,204,641 T321I probably damaging Het
Other mutations in Zfp948
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Zfp948 APN 17 21587071 missense probably benign 0.01
R0212:Zfp948 UTSW 17 21588160 missense probably benign 0.01
R0433:Zfp948 UTSW 17 21587502 missense probably benign 0.02
R0437:Zfp948 UTSW 17 21586998 missense unknown
R0490:Zfp948 UTSW 17 21588034 missense probably benign 0.02
R1245:Zfp948 UTSW 17 21586842 missense probably damaging 1.00
R1818:Zfp948 UTSW 17 21584807 missense probably damaging 1.00
R2106:Zfp948 UTSW 17 21587691 nonsense probably null
R3692:Zfp948 UTSW 17 21587576 missense probably benign 0.01
R4767:Zfp948 UTSW 17 21588307 missense possibly damaging 0.61
R5226:Zfp948 UTSW 17 21588243 missense probably benign 0.00
R5753:Zfp948 UTSW 17 21586894 missense probably damaging 0.97
R5766:Zfp948 UTSW 17 21584816 missense probably benign 0.02
R5959:Zfp948 UTSW 17 21587514 missense probably benign 0.01
R6167:Zfp948 UTSW 17 21587649 missense probably benign 0.38
R6291:Zfp948 UTSW 17 21587024 missense unknown
R6312:Zfp948 UTSW 17 21587167 missense possibly damaging 0.56
R6482:Zfp948 UTSW 17 21587551 missense probably benign 0.01
R7046:Zfp948 UTSW 17 21588457 missense possibly damaging 0.80
R7053:Zfp948 UTSW 17 21584859 nonsense probably null
R7207:Zfp948 UTSW 17 21588340 missense possibly damaging 0.52
R7222:Zfp948 UTSW 17 21587840 missense probably damaging 1.00
R7460:Zfp948 UTSW 17 21588415 missense probably damaging 1.00
R7760:Zfp948 UTSW 17 21588366 missense probably damaging 1.00
R7818:Zfp948 UTSW 17 21587723 missense probably benign 0.14
RF011:Zfp948 UTSW 17 21588312 missense probably damaging 0.97
X0023:Zfp948 UTSW 17 21586860 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggaacagtgggcaaagaatc -3'
Posted On2013-05-09