Incidental Mutation 'R0225:Skor2'
ID33886
Institutional Source Beutler Lab
Gene Symbol Skor2
Ensembl Gene ENSMUSG00000091519
Gene NameSKI family transcriptional corepressor 2
SynonymsGm7348, Fussel18, Corl2
MMRRC Submission 038470-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0225 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location76856405-76900342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76859098 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 172 (I172F)
Ref Sequence ENSEMBL: ENSMUSP00000132338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166956]
Predicted Effect unknown
Transcript: ENSMUST00000166956
AA Change: I172F
SMART Domains Protein: ENSMUSP00000132338
Gene: ENSMUSG00000091519
AA Change: I172F

DomainStartEndE-ValueType
Pfam:Ski_Sno 25 132 2.3e-41 PFAM
c-SKI_SMAD_bind 144 236 6.92e-55 SMART
low complexity region 261 305 N/A INTRINSIC
low complexity region 320 373 N/A INTRINSIC
low complexity region 426 452 N/A INTRINSIC
low complexity region 478 491 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
low complexity region 645 680 N/A INTRINSIC
low complexity region 688 707 N/A INTRINSIC
low complexity region 722 741 N/A INTRINSIC
low complexity region 747 766 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Meta Mutation Damage Score 0.9397 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal and postnatal lethality, abnormal cerebellum development, and abnormal Purkinje cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Col18a1 T C 10: 77,088,914 S14G possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
F11 T C 8: 45,249,077 T267A probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Gadd45b A G 10: 80,930,347 N11S probably benign Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Gm10647 A G 9: 66,798,495 probably benign Het
Gm10936 G A 10: 117,248,130 noncoding transcript Het
Gzmd A G 14: 56,129,704 W244R probably damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kat2b A G 17: 53,641,210 E336G probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif23 C G 9: 61,925,694 probably benign Het
Lgi3 A T 14: 70,532,821 I109L probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Olfr729 T G 14: 50,148,635 K80Q probably damaging Het
Olfr933 A G 9: 38,976,278 I201V probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rapgef2 A T 3: 79,104,105 S224R probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
St14 T A 9: 31,108,284 probably null Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tbxa2r C A 10: 81,332,900 T141K possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Tyms A G 5: 30,063,258 I148T probably damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn1r58 A C 7: 5,410,866 S122A probably benign Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Wfdc8 A G 2: 164,597,185 Y426H probably benign Het
Zfp948 A T 17: 21,587,294 K249N probably damaging Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zyg11a G A 4: 108,204,641 T321I probably damaging Het
Other mutations in Skor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Skor2 APN 18 76858667 missense unknown
IGL01604:Skor2 APN 18 76859951 missense possibly damaging 0.93
IGL02306:Skor2 APN 18 76862679 missense probably benign 0.01
IGL03287:Skor2 APN 18 76876135 missense probably damaging 0.99
R0265:Skor2 UTSW 18 76876598 missense probably damaging 0.99
R0650:Skor2 UTSW 18 76876560 missense probably benign 0.32
R1086:Skor2 UTSW 18 76859299 missense unknown
R1237:Skor2 UTSW 18 76876132 nonsense probably null
R1465:Skor2 UTSW 18 76876645 splice site probably benign
R1625:Skor2 UTSW 18 76858804 missense unknown
R1682:Skor2 UTSW 18 76859516 missense unknown
R1918:Skor2 UTSW 18 76859356 missense unknown
R2878:Skor2 UTSW 18 76860724 nonsense probably null
R3103:Skor2 UTSW 18 76859278 nonsense probably null
R3611:Skor2 UTSW 18 76858838 missense unknown
R3882:Skor2 UTSW 18 76862689 missense probably damaging 0.97
R3891:Skor2 UTSW 18 76858655 missense unknown
R4473:Skor2 UTSW 18 76859461 missense unknown
R4720:Skor2 UTSW 18 76861183 critical splice donor site probably null
R4828:Skor2 UTSW 18 76860418 missense probably damaging 1.00
R4906:Skor2 UTSW 18 76860295 missense possibly damaging 0.73
R5074:Skor2 UTSW 18 76858954 nonsense probably null
R5486:Skor2 UTSW 18 76858700 missense unknown
R5729:Skor2 UTSW 18 76858883 missense unknown
R5886:Skor2 UTSW 18 76859429 missense unknown
R6017:Skor2 UTSW 18 76858927 missense unknown
R6514:Skor2 UTSW 18 76862694 missense probably damaging 1.00
R6565:Skor2 UTSW 18 76859912 missense possibly damaging 0.70
R6909:Skor2 UTSW 18 76860557 missense possibly damaging 0.68
R7169:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7171:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7188:Skor2 UTSW 18 76859809 missense possibly damaging 0.53
R7219:Skor2 UTSW 18 76860401 missense possibly damaging 0.96
R7548:Skor2 UTSW 18 76860905 missense possibly damaging 0.82
R7722:Skor2 UTSW 18 76862644 missense probably benign 0.09
RF015:Skor2 UTSW 18 76860788 missense probably damaging 0.99
Z1176:Skor2 UTSW 18 76860124 missense probably benign 0.15
Z1176:Skor2 UTSW 18 76860670 missense possibly damaging 0.93
Z1176:Skor2 UTSW 18 76861161 missense probably damaging 0.99
Z1177:Skor2 UTSW 18 76876093 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCATGATCACCAAGCGTGAG -3'
(R):5'- AGGGAATCGTCATCGTCGTCGAAG -3'

Sequencing Primer
(F):5'- CCAAGCGTGAGGCCGAG -3'
(R):5'- ACCGTTGAACATGGCCTTG -3'
Posted On2013-05-09