Incidental Mutation 'R0226:Aim2'
ID 33892
Institutional Source Beutler Lab
Gene Symbol Aim2
Ensembl Gene ENSMUSG00000037860
Gene Name absent in melanoma 2
Synonyms Ifi210, LOC383619
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R0226 (G1)
Quality Score 223
Status Validated
Chromosome 1
Chromosomal Location 173178445-173293606 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 173289899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147604] [ENSMUST00000166137] [ENSMUST00000173023]
AlphaFold Q91VJ1
Predicted Effect probably benign
Transcript: ENSMUST00000147604
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166137
SMART Domains Protein: ENSMUSP00000132253
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 321 9.4e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173023
SMART Domains Protein: ENSMUSP00000134329
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192575
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased susceptibility to bacterial and viral infections with altered cytokine production and inflammatory cell death (pyrotosis). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Aasdh A T 5: 77,049,849 (GRCm39) L49Q probably damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Ablim1 A T 19: 57,032,302 (GRCm39) L556Q probably damaging Het
Afdn A G 17: 14,119,408 (GRCm39) T1700A probably benign Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Agpat3 T A 10: 78,113,863 (GRCm39) H275L possibly damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fbn1 C T 2: 125,162,830 (GRCm39) R2152Q possibly damaging Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Rnf43 A T 11: 87,622,263 (GRCm39) S455C probably damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Treml1 C T 17: 48,667,486 (GRCm39) L124F probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp277 A G 12: 40,414,161 (GRCm39) L228S possibly damaging Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Aim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Aim2 APN 1 173,283,031 (GRCm39) missense probably benign 0.23
IGL01086:Aim2 APN 1 173,282,999 (GRCm39) missense probably damaging 0.99
IGL02292:Aim2 APN 1 173,289,840 (GRCm39) missense probably benign 0.05
IGL02382:Aim2 APN 1 173,287,315 (GRCm39) splice site probably null
R0609:Aim2 UTSW 1 173,289,530 (GRCm39) missense probably damaging 0.98
R1281:Aim2 UTSW 1 173,287,377 (GRCm39) nonsense probably null
R2054:Aim2 UTSW 1 173,291,548 (GRCm39) missense probably damaging 1.00
R2110:Aim2 UTSW 1 173,287,279 (GRCm39) missense probably benign 0.00
R4080:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4081:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4082:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4452:Aim2 UTSW 1 173,283,010 (GRCm39) missense possibly damaging 0.63
R4647:Aim2 UTSW 1 173,283,090 (GRCm39) synonymous silent
R4731:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4732:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4733:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4923:Aim2 UTSW 1 173,287,372 (GRCm39) missense probably benign 0.04
R5009:Aim2 UTSW 1 173,282,932 (GRCm39) missense probably damaging 0.96
R6290:Aim2 UTSW 1 173,289,681 (GRCm39) missense possibly damaging 0.48
R6372:Aim2 UTSW 1 173,282,802 (GRCm39) splice site probably null
R6821:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6836:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6838:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6994:Aim2 UTSW 1 173,283,152 (GRCm39) missense possibly damaging 0.80
R7893:Aim2 UTSW 1 173,291,492 (GRCm39) missense possibly damaging 0.95
R8175:Aim2 UTSW 1 173,282,920 (GRCm39) start codon destroyed possibly damaging 0.75
R8459:Aim2 UTSW 1 173,289,536 (GRCm39) unclassified probably benign
R8680:Aim2 UTSW 1 173,289,786 (GRCm39) missense probably damaging 1.00
X0021:Aim2 UTSW 1 173,291,485 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGAGGTCACCAGTTCCTCAG -3'
(R):5'- TGCTTCAGAAGCTACAAGGCGG -3'

Sequencing Primer
(F):5'- ACCAGTTCCTCAGTTGTGG -3'
(R):5'- gccacataagacaaagccac -3'
Posted On 2013-05-09