Incidental Mutation 'R0226:Fbn1'
ID 33901
Institutional Source Beutler Lab
Gene Symbol Fbn1
Ensembl Gene ENSMUSG00000027204
Gene Name fibrillin 1
Synonyms Fib-1
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.916) question?
Stock # R0226 (G1)
Quality Score 188
Status Validated
Chromosome 2
Chromosomal Location 125142514-125348417 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 125162830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 2152 (R2152Q)
Ref Sequence ENSEMBL: ENSMUSP00000099524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000028633
AA Change: R2152Q

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: R2152Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 193 235 6.9e-17 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 343 388 2.3e-17 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 670 712 1.4e-17 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 862 902 2.1e-14 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 967 1009 3.9e-17 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1549 1590 3.5e-18 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1706 1749 9.7e-18 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2070 2112 3.7e-17 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2348 2391 8.5e-18 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103234
AA Change: R2152Q

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: R2152Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 194 232 3.5e-10 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 344 388 6.8e-15 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 671 712 8.3e-16 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 863 898 3.1e-8 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 968 1009 1.5e-15 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1550 1590 5.3e-17 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1707 1749 1.6e-16 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2071 2112 1.9e-15 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2349 2391 5.8e-15 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Aasdh A T 5: 77,049,849 (GRCm39) L49Q probably damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Ablim1 A T 19: 57,032,302 (GRCm39) L556Q probably damaging Het
Afdn A G 17: 14,119,408 (GRCm39) T1700A probably benign Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Agpat3 T A 10: 78,113,863 (GRCm39) H275L possibly damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Aim2 A G 1: 173,289,899 (GRCm39) probably benign Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Rnf43 A T 11: 87,622,263 (GRCm39) S455C probably damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Treml1 C T 17: 48,667,486 (GRCm39) L124F probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp277 A G 12: 40,414,161 (GRCm39) L228S possibly damaging Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Fbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fbn1 APN 2 125,166,867 (GRCm39) missense probably damaging 1.00
IGL00159:Fbn1 APN 2 125,239,793 (GRCm39) missense probably benign 0.14
IGL00500:Fbn1 APN 2 125,159,436 (GRCm39) missense probably damaging 0.99
IGL00558:Fbn1 APN 2 125,171,048 (GRCm39) splice site probably benign
IGL00645:Fbn1 APN 2 125,159,023 (GRCm39) splice site probably benign
IGL00863:Fbn1 APN 2 125,245,139 (GRCm39) missense possibly damaging 0.84
IGL00926:Fbn1 APN 2 125,160,962 (GRCm39) missense possibly damaging 0.84
IGL00935:Fbn1 APN 2 125,219,830 (GRCm39) nonsense probably null
IGL00950:Fbn1 APN 2 125,200,743 (GRCm39) missense probably damaging 1.00
IGL01090:Fbn1 APN 2 125,236,696 (GRCm39) splice site probably benign
IGL01106:Fbn1 APN 2 125,193,626 (GRCm39) missense possibly damaging 0.55
IGL01486:Fbn1 APN 2 125,231,898 (GRCm39) missense probably benign 0.03
IGL01519:Fbn1 APN 2 125,158,939 (GRCm39) missense probably benign 0.07
IGL01585:Fbn1 APN 2 125,202,030 (GRCm39) missense probably damaging 0.98
IGL01730:Fbn1 APN 2 125,154,894 (GRCm39) splice site probably benign
IGL01793:Fbn1 APN 2 125,229,213 (GRCm39) missense possibly damaging 0.67
IGL01803:Fbn1 APN 2 125,192,207 (GRCm39) missense probably damaging 1.00
IGL01803:Fbn1 APN 2 125,143,645 (GRCm39) missense probably benign
IGL01916:Fbn1 APN 2 125,157,366 (GRCm39) missense possibly damaging 0.55
IGL02035:Fbn1 APN 2 125,177,282 (GRCm39) splice site probably null
IGL02097:Fbn1 APN 2 125,205,889 (GRCm39) missense probably damaging 1.00
IGL02233:Fbn1 APN 2 125,163,530 (GRCm39) splice site probably benign
IGL02512:Fbn1 APN 2 125,180,380 (GRCm39) missense probably damaging 1.00
IGL02552:Fbn1 APN 2 125,254,633 (GRCm39) missense possibly damaging 0.86
IGL02657:Fbn1 APN 2 125,193,945 (GRCm39) missense possibly damaging 0.86
IGL02718:Fbn1 APN 2 125,211,806 (GRCm39) missense probably damaging 1.00
IGL02863:Fbn1 APN 2 125,145,176 (GRCm39) missense possibly damaging 0.80
IGL02974:Fbn1 APN 2 125,188,250 (GRCm39) missense probably null 0.99
IGL03058:Fbn1 APN 2 125,245,120 (GRCm39) missense probably benign 0.03
IGL03172:Fbn1 APN 2 125,162,888 (GRCm39) missense possibly damaging 0.92
IGL03288:Fbn1 APN 2 125,145,103 (GRCm39) missense probably benign 0.13
Carinatum UTSW 2 125,184,750 (GRCm39) missense possibly damaging 0.70
Elasticity UTSW 2 125,245,052 (GRCm39) missense possibly damaging 0.63
Excavatum UTSW 2 125,177,407 (GRCm39) missense probably damaging 1.00
Exceedingly UTSW 2 125,186,015 (GRCm39) critical splice acceptor site probably benign
Extensor UTSW 2 125,170,078 (GRCm39) missense probably damaging 1.00
lincoln UTSW 2 125,245,090 (GRCm39) missense possibly damaging 0.50
Long UTSW 2 125,158,958 (GRCm39) missense probably damaging 1.00
Pectus UTSW 2 125,163,611 (GRCm39) missense possibly damaging 0.82
Reach UTSW 2 125,223,954 (GRCm39) nonsense probably null
reaper UTSW 2 125,157,324 (GRCm39) missense probably damaging 0.98
Scythe UTSW 2 125,245,148 (GRCm39) missense possibly damaging 0.84
String_bean UTSW 2 125,221,054 (GRCm39) splice site probably null
wirey UTSW 2 125,151,415 (GRCm39) missense probably benign
3-1:Fbn1 UTSW 2 125,236,525 (GRCm39) splice site probably benign
BB004:Fbn1 UTSW 2 125,225,656 (GRCm39) missense possibly damaging 0.82
BB014:Fbn1 UTSW 2 125,225,656 (GRCm39) missense possibly damaging 0.82
P0012:Fbn1 UTSW 2 125,211,241 (GRCm39) splice site probably benign
PIT4403001:Fbn1 UTSW 2 125,184,831 (GRCm39) missense probably damaging 1.00
PIT4466001:Fbn1 UTSW 2 125,148,421 (GRCm39) missense possibly damaging 0.90
PIT4472001:Fbn1 UTSW 2 125,148,421 (GRCm39) missense possibly damaging 0.90
PIT4651001:Fbn1 UTSW 2 125,205,909 (GRCm39) critical splice acceptor site probably null
R0310:Fbn1 UTSW 2 125,205,564 (GRCm39) missense probably damaging 1.00
R0362:Fbn1 UTSW 2 125,151,697 (GRCm39) missense probably damaging 0.99
R0374:Fbn1 UTSW 2 125,163,596 (GRCm39) missense possibly damaging 0.86
R0433:Fbn1 UTSW 2 125,190,135 (GRCm39) missense possibly damaging 0.95
R0441:Fbn1 UTSW 2 125,151,675 (GRCm39) critical splice donor site probably null
R0501:Fbn1 UTSW 2 125,143,669 (GRCm39) missense probably benign 0.23
R0510:Fbn1 UTSW 2 125,184,845 (GRCm39) splice site probably benign
R0573:Fbn1 UTSW 2 125,231,169 (GRCm39) missense probably damaging 0.99
R0622:Fbn1 UTSW 2 125,220,944 (GRCm39) missense possibly damaging 0.88
R0630:Fbn1 UTSW 2 125,236,690 (GRCm39) missense possibly damaging 0.48
R0724:Fbn1 UTSW 2 125,193,984 (GRCm39) missense probably benign 0.14
R0739:Fbn1 UTSW 2 125,209,550 (GRCm39) missense probably benign 0.18
R0744:Fbn1 UTSW 2 125,156,734 (GRCm39) splice site probably benign
R0811:Fbn1 UTSW 2 125,245,090 (GRCm39) missense possibly damaging 0.50
R0812:Fbn1 UTSW 2 125,245,090 (GRCm39) missense possibly damaging 0.50
R0862:Fbn1 UTSW 2 125,184,811 (GRCm39) nonsense probably null
R0864:Fbn1 UTSW 2 125,184,811 (GRCm39) nonsense probably null
R1061:Fbn1 UTSW 2 125,187,883 (GRCm39) missense probably benign 0.01
R1126:Fbn1 UTSW 2 125,163,112 (GRCm39) splice site probably null
R1172:Fbn1 UTSW 2 125,236,607 (GRCm39) missense probably benign 0.13
R1175:Fbn1 UTSW 2 125,236,607 (GRCm39) missense probably benign 0.13
R1183:Fbn1 UTSW 2 125,163,537 (GRCm39) missense probably benign 0.07
R1218:Fbn1 UTSW 2 125,254,669 (GRCm39) missense possibly damaging 0.71
R1241:Fbn1 UTSW 2 125,214,447 (GRCm39) splice site probably benign
R1248:Fbn1 UTSW 2 125,143,529 (GRCm39) missense probably benign 0.01
R1345:Fbn1 UTSW 2 125,156,591 (GRCm39) missense probably damaging 1.00
R1374:Fbn1 UTSW 2 125,188,354 (GRCm39) missense probably damaging 0.99
R1458:Fbn1 UTSW 2 125,143,849 (GRCm39) missense probably benign 0.01
R1474:Fbn1 UTSW 2 125,203,185 (GRCm39) missense possibly damaging 0.72
R1496:Fbn1 UTSW 2 125,151,415 (GRCm39) missense probably benign
R1502:Fbn1 UTSW 2 125,205,626 (GRCm39) nonsense probably null
R1511:Fbn1 UTSW 2 125,148,205 (GRCm39) missense probably benign 0.00
R1588:Fbn1 UTSW 2 125,161,034 (GRCm39) missense probably benign 0.19
R1626:Fbn1 UTSW 2 125,183,199 (GRCm39) missense probably damaging 1.00
R1676:Fbn1 UTSW 2 125,151,701 (GRCm39) missense probably damaging 1.00
R1712:Fbn1 UTSW 2 125,188,354 (GRCm39) missense probably damaging 0.99
R1772:Fbn1 UTSW 2 125,245,148 (GRCm39) missense possibly damaging 0.84
R1776:Fbn1 UTSW 2 125,163,654 (GRCm39) missense possibly damaging 0.71
R1869:Fbn1 UTSW 2 125,193,947 (GRCm39) missense probably benign 0.00
R1894:Fbn1 UTSW 2 125,236,541 (GRCm39) missense probably damaging 0.96
R1925:Fbn1 UTSW 2 125,205,549 (GRCm39) missense probably damaging 1.00
R1957:Fbn1 UTSW 2 125,209,574 (GRCm39) missense possibly damaging 0.93
R1995:Fbn1 UTSW 2 125,192,293 (GRCm39) critical splice acceptor site probably null
R2140:Fbn1 UTSW 2 125,185,730 (GRCm39) missense probably damaging 1.00
R2142:Fbn1 UTSW 2 125,254,628 (GRCm39) missense possibly damaging 0.93
R2268:Fbn1 UTSW 2 125,163,661 (GRCm39) missense possibly damaging 0.49
R3409:Fbn1 UTSW 2 125,254,585 (GRCm39) missense possibly damaging 0.92
R3418:Fbn1 UTSW 2 125,162,846 (GRCm39) missense possibly damaging 0.55
R3508:Fbn1 UTSW 2 125,148,247 (GRCm39) missense probably benign 0.19
R3778:Fbn1 UTSW 2 125,159,006 (GRCm39) missense probably damaging 1.00
R3800:Fbn1 UTSW 2 125,187,894 (GRCm39) missense possibly damaging 0.63
R4001:Fbn1 UTSW 2 125,319,415 (GRCm39) critical splice donor site probably null
R4169:Fbn1 UTSW 2 125,205,872 (GRCm39) missense possibly damaging 0.86
R4398:Fbn1 UTSW 2 125,239,701 (GRCm39) missense probably benign 0.32
R4482:Fbn1 UTSW 2 125,205,530 (GRCm39) critical splice donor site probably null
R4559:Fbn1 UTSW 2 125,193,634 (GRCm39) missense possibly damaging 0.65
R4608:Fbn1 UTSW 2 125,148,420 (GRCm39) missense probably benign 0.05
R4634:Fbn1 UTSW 2 125,185,981 (GRCm39) missense probably damaging 1.00
R4706:Fbn1 UTSW 2 125,212,069 (GRCm39) missense probably benign 0.21
R4712:Fbn1 UTSW 2 125,183,236 (GRCm39) missense probably benign 0.12
R4783:Fbn1 UTSW 2 125,166,839 (GRCm39) missense probably damaging 1.00
R4784:Fbn1 UTSW 2 125,166,839 (GRCm39) missense probably damaging 1.00
R4785:Fbn1 UTSW 2 125,166,839 (GRCm39) missense probably damaging 1.00
R4793:Fbn1 UTSW 2 125,163,155 (GRCm39) nonsense probably null
R4838:Fbn1 UTSW 2 125,214,319 (GRCm39) missense probably benign 0.01
R4864:Fbn1 UTSW 2 125,214,317 (GRCm39) missense possibly damaging 0.92
R4887:Fbn1 UTSW 2 125,151,694 (GRCm39) missense probably damaging 1.00
R4942:Fbn1 UTSW 2 125,225,536 (GRCm39) missense possibly damaging 0.88
R4952:Fbn1 UTSW 2 125,159,454 (GRCm39) missense probably damaging 1.00
R5030:Fbn1 UTSW 2 125,254,624 (GRCm39) missense possibly damaging 0.51
R5044:Fbn1 UTSW 2 125,171,022 (GRCm39) missense probably damaging 0.97
R5057:Fbn1 UTSW 2 125,308,615 (GRCm39) missense probably benign 0.33
R5115:Fbn1 UTSW 2 125,174,303 (GRCm39) missense probably damaging 1.00
R5399:Fbn1 UTSW 2 125,174,253 (GRCm39) missense possibly damaging 0.69
R5498:Fbn1 UTSW 2 125,202,096 (GRCm39) missense probably damaging 1.00
R5526:Fbn1 UTSW 2 125,207,559 (GRCm39) missense possibly damaging 0.83
R5529:Fbn1 UTSW 2 125,215,870 (GRCm39) missense probably benign 0.01
R5602:Fbn1 UTSW 2 125,163,661 (GRCm39) missense possibly damaging 0.49
R5760:Fbn1 UTSW 2 125,203,167 (GRCm39) missense probably damaging 1.00
R5837:Fbn1 UTSW 2 125,221,054 (GRCm39) splice site probably null
R5955:Fbn1 UTSW 2 125,200,802 (GRCm39) missense probably damaging 1.00
R5980:Fbn1 UTSW 2 125,157,324 (GRCm39) missense probably damaging 0.98
R6039:Fbn1 UTSW 2 125,205,800 (GRCm39) missense probably damaging 1.00
R6039:Fbn1 UTSW 2 125,205,800 (GRCm39) missense probably damaging 1.00
R6058:Fbn1 UTSW 2 125,308,532 (GRCm39) missense possibly damaging 0.73
R6089:Fbn1 UTSW 2 125,163,145 (GRCm39) missense possibly damaging 0.55
R6136:Fbn1 UTSW 2 125,245,052 (GRCm39) missense possibly damaging 0.63
R6161:Fbn1 UTSW 2 125,211,721 (GRCm39) nonsense probably null
R6162:Fbn1 UTSW 2 125,202,147 (GRCm39) missense probably damaging 1.00
R6165:Fbn1 UTSW 2 125,174,283 (GRCm39) missense probably damaging 0.99
R6169:Fbn1 UTSW 2 125,177,409 (GRCm39) critical splice acceptor site probably null
R6221:Fbn1 UTSW 2 125,162,841 (GRCm39) missense probably benign 0.07
R6223:Fbn1 UTSW 2 125,254,591 (GRCm39) missense possibly damaging 0.86
R6225:Fbn1 UTSW 2 125,172,463 (GRCm39) missense probably damaging 1.00
R6238:Fbn1 UTSW 2 125,166,865 (GRCm39) missense probably damaging 0.98
R6329:Fbn1 UTSW 2 125,150,393 (GRCm39) missense possibly damaging 0.70
R6401:Fbn1 UTSW 2 125,188,370 (GRCm39) missense probably damaging 0.98
R6480:Fbn1 UTSW 2 125,177,338 (GRCm39) missense probably benign 0.05
R6513:Fbn1 UTSW 2 125,225,591 (GRCm39) missense probably damaging 1.00
R6530:Fbn1 UTSW 2 125,231,190 (GRCm39) missense probably damaging 0.99
R6595:Fbn1 UTSW 2 125,184,750 (GRCm39) missense possibly damaging 0.70
R6781:Fbn1 UTSW 2 125,158,958 (GRCm39) missense probably damaging 1.00
R6849:Fbn1 UTSW 2 125,163,611 (GRCm39) missense possibly damaging 0.82
R6860:Fbn1 UTSW 2 125,170,078 (GRCm39) missense probably damaging 1.00
R6960:Fbn1 UTSW 2 125,223,980 (GRCm39) missense probably benign 0.16
R7134:Fbn1 UTSW 2 125,223,969 (GRCm39) missense probably benign 0.03
R7241:Fbn1 UTSW 2 125,148,415 (GRCm39) missense possibly damaging 0.86
R7295:Fbn1 UTSW 2 125,177,407 (GRCm39) missense probably damaging 1.00
R7312:Fbn1 UTSW 2 125,308,594 (GRCm39) missense possibly damaging 0.53
R7322:Fbn1 UTSW 2 125,321,115 (GRCm39) missense possibly damaging 0.92
R7349:Fbn1 UTSW 2 125,157,321 (GRCm39) missense possibly damaging 0.84
R7365:Fbn1 UTSW 2 125,193,969 (GRCm39) missense probably damaging 0.97
R7392:Fbn1 UTSW 2 125,185,844 (GRCm39) missense probably damaging 1.00
R7442:Fbn1 UTSW 2 125,245,132 (GRCm39) missense possibly damaging 0.45
R7452:Fbn1 UTSW 2 125,347,375 (GRCm39) missense possibly damaging 0.53
R7453:Fbn1 UTSW 2 125,162,879 (GRCm39) missense possibly damaging 0.93
R7457:Fbn1 UTSW 2 125,193,667 (GRCm39) missense possibly damaging 0.90
R7458:Fbn1 UTSW 2 125,161,036 (GRCm39) missense probably benign 0.14
R7549:Fbn1 UTSW 2 125,185,947 (GRCm39) missense probably damaging 0.99
R7570:Fbn1 UTSW 2 125,239,772 (GRCm39) missense probably benign 0.29
R7666:Fbn1 UTSW 2 125,148,391 (GRCm39) missense probably damaging 1.00
R7723:Fbn1 UTSW 2 125,223,954 (GRCm39) nonsense probably null
R7745:Fbn1 UTSW 2 125,145,115 (GRCm39) missense probably benign 0.06
R7754:Fbn1 UTSW 2 125,321,200 (GRCm39) splice site probably null
R7780:Fbn1 UTSW 2 125,143,678 (GRCm39) missense probably benign 0.15
R7849:Fbn1 UTSW 2 125,151,405 (GRCm39) missense probably damaging 0.98
R7927:Fbn1 UTSW 2 125,225,656 (GRCm39) missense possibly damaging 0.82
R7942:Fbn1 UTSW 2 125,254,706 (GRCm39) missense possibly damaging 0.53
R7948:Fbn1 UTSW 2 125,183,219 (GRCm39) missense probably damaging 1.00
R7985:Fbn1 UTSW 2 125,143,798 (GRCm39) missense probably benign 0.01
R8051:Fbn1 UTSW 2 125,148,383 (GRCm39) missense possibly damaging 0.86
R8054:Fbn1 UTSW 2 125,187,938 (GRCm39) missense possibly damaging 0.93
R8058:Fbn1 UTSW 2 125,193,889 (GRCm39) missense possibly damaging 0.46
R8113:Fbn1 UTSW 2 125,319,489 (GRCm39) missense probably damaging 1.00
R8307:Fbn1 UTSW 2 125,347,402 (GRCm39) missense possibly damaging 0.53
R8472:Fbn1 UTSW 2 125,151,722 (GRCm39) missense probably damaging 1.00
R8690:Fbn1 UTSW 2 125,186,015 (GRCm39) critical splice acceptor site probably benign
R8724:Fbn1 UTSW 2 125,202,066 (GRCm39) missense probably damaging 0.98
R8856:Fbn1 UTSW 2 125,156,637 (GRCm39) missense probably damaging 1.00
R8916:Fbn1 UTSW 2 125,245,149 (GRCm39) missense possibly damaging 0.63
R8931:Fbn1 UTSW 2 125,202,095 (GRCm39) missense probably damaging 1.00
R8988:Fbn1 UTSW 2 125,212,726 (GRCm39) missense possibly damaging 0.88
R9127:Fbn1 UTSW 2 125,223,985 (GRCm39) missense possibly damaging 0.86
R9161:Fbn1 UTSW 2 125,192,270 (GRCm39) missense probably damaging 1.00
R9495:Fbn1 UTSW 2 125,160,984 (GRCm39) missense probably damaging 0.96
R9515:Fbn1 UTSW 2 125,207,551 (GRCm39) missense probably benign 0.03
R9557:Fbn1 UTSW 2 125,180,458 (GRCm39) missense probably damaging 0.99
R9597:Fbn1 UTSW 2 125,187,906 (GRCm39) missense probably benign
R9680:Fbn1 UTSW 2 125,310,484 (GRCm39) missense probably benign 0.29
R9723:Fbn1 UTSW 2 125,202,119 (GRCm39) nonsense probably null
R9734:Fbn1 UTSW 2 125,231,898 (GRCm39) missense probably benign 0.03
R9796:Fbn1 UTSW 2 125,158,941 (GRCm39) missense probably benign 0.19
X0019:Fbn1 UTSW 2 125,225,563 (GRCm39) missense possibly damaging 0.82
X0020:Fbn1 UTSW 2 125,211,260 (GRCm39) missense probably damaging 1.00
X0028:Fbn1 UTSW 2 125,184,718 (GRCm39) critical splice donor site probably null
X0067:Fbn1 UTSW 2 125,211,834 (GRCm39) missense possibly damaging 0.95
Z1088:Fbn1 UTSW 2 125,192,208 (GRCm39) missense probably damaging 0.99
Z1176:Fbn1 UTSW 2 125,229,270 (GRCm39) missense possibly damaging 0.51
Z1177:Fbn1 UTSW 2 125,231,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTGGAGGAACAGAACATGAC -3'
(R):5'- CTGATGACTCAGCAGTTGGTGAGTG -3'

Sequencing Primer
(F):5'- AGAACATGACTCGTACCTTGG -3'
(R):5'- AGTGCCCAGCTAGGTCTTC -3'
Posted On 2013-05-09