Mutagenetix > Incidental Mutation

Incidental Mutation 'R0226:Fbn1'

33901

Institutional Source

Beutler Lab

Gene Symbol

Fbn1

Ensembl Gene

ENSMUSG00000027204

Gene Name

fibrillin 1

Synonyms

Fib-1

MMRRC Submission

038471-MU

Accession Numbers

Genbank: NM_007993; MGI: 95489

Essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R0226 (G1)

Quality Score

188

Status

Validated

Chromosome

Chromosomal Location

125300594-125507993 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 125320910 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 2152 (R2152Q)

Ref Sequence

ENSEMBL: ENSMUSP00000099524 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028633
AA Change: R2152Q

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: R2152Q

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	38	49	N/A	INTRINSIC
EGF	118	146	8.52e0	SMART
EGF	149	178	5.4e-2	SMART
Pfam:TB	193	235	6.9e-17	PFAM
EGF_CA	246	287	3.56e-11	SMART
EGF_CA	288	329	9.39e-11	SMART
Pfam:TB	343	388	2.3e-17	PFAM
low complexity region	394	445	N/A	INTRINSIC
EGF	454	491	8.57e-5	SMART
EGF_CA	492	531	9.39e-11	SMART
EGF_CA	532	573	2.38e-12	SMART
EGF_CA	574	614	5.48e-12	SMART
EGF_CA	615	655	5.39e-11	SMART
Pfam:TB	670	712	1.4e-17	PFAM
EGF_CA	725	766	1.53e-10	SMART
EGF_CA	767	808	2.42e-13	SMART
EGF_CA	809	848	2.44e-9	SMART
Pfam:TB	862	902	2.1e-14	PFAM
EGF_CA	912	953	3.32e-11	SMART
Pfam:TB	967	1009	3.9e-17	PFAM
EGF_CA	1030	1071	5.11e-12	SMART
EGF_CA	1072	1114	5.39e-11	SMART
EGF_CA	1115	1156	1.55e-11	SMART
EGF_CA	1157	1198	5.48e-12	SMART
EGF_CA	1199	1239	5.61e-9	SMART
EGF_CA	1240	1281	1.22e-9	SMART
EGF_CA	1282	1323	2.62e-9	SMART
EGF_CA	1324	1364	3.27e-10	SMART
EGF_CA	1365	1405	4.7e-11	SMART
EGF_CA	1406	1447	1.91e-11	SMART
EGF_CA	1448	1488	1.98e-9	SMART
EGF_CA	1489	1529	2.13e-9	SMART
Pfam:TB	1549	1590	3.5e-18	PFAM
EGF_CA	1608	1649	2.19e-11	SMART
EGF_CA	1650	1690	3.97e-9	SMART
Pfam:TB	1706	1749	9.7e-18	PFAM
EGF_CA	1768	1809	5.11e-12	SMART
EGF_CA	1810	1850	1.1e-11	SMART
EGF_CA	1851	1892	5.69e-10	SMART
EGF_CA	1893	1931	6.1e-10	SMART
EGF_CA	1932	1974	2.11e-13	SMART
EGF_CA	1975	2014	7.23e-12	SMART
EGF_CA	2015	2056	3.15e-12	SMART
Pfam:TB	2070	2112	3.7e-17	PFAM
EGF_CA	2129	2167	1.24e-10	SMART
EGF_CA	2168	2207	3.81e-11	SMART
EGF_CA	2208	2248	3.81e-11	SMART
EGF	2252	2292	5.24e0	SMART
EGF_CA	2293	2334	9.91e-10	SMART
Pfam:TB	2348	2391	8.5e-18	PFAM
EGF_CA	2404	2445	1.26e-11	SMART
EGF_CA	2446	2486	1.06e-9	SMART
EGF_CA	2487	2525	3.1e-11	SMART
EGF_CA	2526	2568	1.48e-8	SMART
EGF_CA	2569	2608	1.14e-9	SMART
EGF_CA	2609	2649	3.97e-9	SMART
EGF_CA	2650	2689	1.98e-9	SMART
low complexity region	2691	2698	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103234
AA Change: R2152Q

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: R2152Q

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	38	49	N/A	INTRINSIC
EGF	118	146	8.52e0	SMART
EGF	149	178	5.4e-2	SMART
Pfam:TB	194	232	3.5e-10	PFAM
EGF_CA	246	287	3.56e-11	SMART
EGF_CA	288	329	9.39e-11	SMART
Pfam:TB	344	388	6.8e-15	PFAM
low complexity region	394	445	N/A	INTRINSIC
EGF	454	491	8.57e-5	SMART
EGF_CA	492	531	9.39e-11	SMART
EGF_CA	532	573	2.38e-12	SMART
EGF_CA	574	614	5.48e-12	SMART
EGF_CA	615	655	5.39e-11	SMART
Pfam:TB	671	712	8.3e-16	PFAM
EGF_CA	725	766	1.53e-10	SMART
EGF_CA	767	808	2.42e-13	SMART
EGF_CA	809	848	2.44e-9	SMART
Pfam:TB	863	898	3.1e-8	PFAM
EGF_CA	912	953	3.32e-11	SMART
Pfam:TB	968	1009	1.5e-15	PFAM
EGF_CA	1030	1071	5.11e-12	SMART
EGF_CA	1072	1114	5.39e-11	SMART
EGF_CA	1115	1156	1.55e-11	SMART
EGF_CA	1157	1198	5.48e-12	SMART
EGF_CA	1199	1239	5.61e-9	SMART
EGF_CA	1240	1281	1.22e-9	SMART
EGF_CA	1282	1323	2.62e-9	SMART
EGF_CA	1324	1364	3.27e-10	SMART
EGF_CA	1365	1405	4.7e-11	SMART
EGF_CA	1406	1447	1.91e-11	SMART
EGF_CA	1448	1488	1.98e-9	SMART
EGF_CA	1489	1529	2.13e-9	SMART
Pfam:TB	1550	1590	5.3e-17	PFAM
EGF_CA	1608	1649	2.19e-11	SMART
EGF_CA	1650	1690	3.97e-9	SMART
Pfam:TB	1707	1749	1.6e-16	PFAM
EGF_CA	1768	1809	5.11e-12	SMART
EGF_CA	1810	1850	1.1e-11	SMART
EGF_CA	1851	1892	5.69e-10	SMART
EGF_CA	1893	1931	6.1e-10	SMART
EGF_CA	1932	1974	2.11e-13	SMART
EGF_CA	1975	2014	7.23e-12	SMART
EGF_CA	2015	2056	3.15e-12	SMART
Pfam:TB	2071	2112	1.9e-15	PFAM
EGF_CA	2129	2167	1.24e-10	SMART
EGF_CA	2168	2207	3.81e-11	SMART
EGF_CA	2208	2248	3.81e-11	SMART
EGF	2252	2292	5.24e0	SMART
EGF_CA	2293	2334	9.91e-10	SMART
Pfam:TB	2349	2391	5.8e-15	PFAM
EGF_CA	2404	2445	1.26e-11	SMART
EGF_CA	2446	2486	1.06e-9	SMART
EGF_CA	2487	2525	3.1e-11	SMART
EGF_CA	2526	2568	1.48e-8	SMART
EGF_CA	2569	2608	1.14e-9	SMART
EGF_CA	2609	2649	3.97e-9	SMART
EGF_CA	2650	2689	1.98e-9	SMART
low complexity region	2691	2698	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (98/98)

MGI Phenotype

Strain: 1934905; 4880665
Lethality: D7-D10
FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	G	T	14: 59,142,120	T54K	possibly damaging	Het
2210408I21Rik	A	T	13: 77,303,425	E876V	possibly damaging	Het
Aasdh	A	T	5: 76,902,002	L49Q	probably damaging	Het
Abca8b	T	C	11: 109,957,018		probably null	Het
Ablim1	A	T	19: 57,043,870	L556Q	probably damaging	Het
Afdn	A	G	17: 13,899,146	T1700A	probably benign	Het
Agl	G	A	3: 116,752,071	R1359C	probably damaging	Het
Agpat3	T	A	10: 78,278,029	H275L	possibly damaging	Het
Ahcyl1	A	T	3: 107,670,270	C180*	probably null	Het
Aim2	A	G	1: 173,462,333		probably benign	Het
Angpt1	T	C	15: 42,468,235	N320S	probably benign	Het
Ankrd52	T	A	10: 128,389,858		probably null	Het
Ap1g1	C	T	8: 109,855,062	S654L	probably benign	Het
Bpifa1	T	A	2: 154,146,057	S173R	probably benign	Het
Brd8	T	C	18: 34,603,894		probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
C1qtnf2	A	G	11: 43,490,843	T161A	probably benign	Het
Car6	T	C	4: 150,187,508	Y228C	probably damaging	Het
Ccdc149	A	G	5: 52,400,217	L273P	probably damaging	Het
Cit	G	A	5: 115,984,840	R1405Q	probably damaging	Het
Cox17	T	C	16: 38,349,276	L48P	probably damaging	Het
Cttn	A	G	7: 144,441,852		probably benign	Het
Cyp4f18	T	C	8: 71,989,775		probably benign	Het
Dtnbp1	A	G	13: 44,923,193	L175P	probably damaging	Het
Efl1	T	C	7: 82,693,011		probably benign	Het
Fignl1	A	T	11: 11,801,061	S665T	probably benign	Het
Gm884	A	T	11: 103,603,241	F663L	probably benign	Het
Gm9843	A	T	16: 76,403,561		noncoding transcript	Het
Gpr155	C	T	2: 73,367,592	V395I	probably benign	Het
Greb1l	T	C	18: 10,522,076		probably benign	Het
Hdgfl1	A	T	13: 26,769,996	H31Q	probably benign	Het
Heatr1	T	C	13: 12,410,562	S628P	probably damaging	Het
Hivep2	A	G	10: 14,129,712	T685A	probably benign	Het
Hmgcl	T	G	4: 135,958,728	V168G	probably damaging	Het
Itch	T	C	2: 155,199,394	I454T	probably benign	Het
Itih2	T	C	2: 10,115,299	D309G	possibly damaging	Het
Kcmf1	T	C	6: 72,842,952	I304V	probably benign	Het
Kcnh1	G	A	1: 192,276,804	W222*	probably null	Het
Kcnh1	G	T	1: 192,276,805	W222C	probably damaging	Het
Kif24	T	A	4: 41,414,939	K287*	probably null	Het
Lrig3	A	G	10: 125,972,117		probably benign	Het
Lrp2	A	T	2: 69,537,563	C202S	probably null	Het
Lrrn2	A	G	1: 132,937,820	N208D	probably damaging	Het
Mcm5	C	T	8: 75,126,252	T664I	possibly damaging	Het
Mfsd10	A	G	5: 34,634,446	L365S	probably benign	Het
Mfsd6	A	G	1: 52,658,690		probably benign	Het
Mgat4e	A	G	1: 134,541,103	V401A	probably benign	Het
Mllt3	C	A	4: 87,840,732	V360L	probably benign	Het
Mrm1	G	A	11: 84,819,170	A68V	possibly damaging	Het
Myo19	A	G	11: 84,897,732		probably benign	Het
Myo3b	A	G	2: 70,217,166	T311A	probably benign	Het
Myo5b	T	C	18: 74,742,180	F1552L	probably benign	Het
Myo7b	C	T	18: 31,972,896	V1353I	probably benign	Het
Myo9b	T	C	8: 71,353,832	S1512P	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Osbpl3	A	G	6: 50,353,008	W63R	probably damaging	Het
Pcdh17	T	C	14: 84,448,201	S703P	probably damaging	Het
Pclo	T	C	5: 14,765,223	I1231T	probably damaging	Het
Pex16	A	C	2: 92,375,687		probably benign	Het
Pfkl	T	C	10: 77,992,534	N399S	probably benign	Het
Pkhd1l1	G	A	15: 44,526,784	R1432K	possibly damaging	Het
Prdm1	T	A	10: 44,456,696	T106S	probably benign	Het
Prrc1	A	G	18: 57,363,291	M105V	probably benign	Het
Psg26	A	G	7: 18,483,958	C12R	possibly damaging	Het
Rnf43	A	T	11: 87,731,437	S455C	probably damaging	Het
Ryr2	T	C	13: 11,772,556	K977R	probably damaging	Het
Sart1	C	T	19: 5,381,122		probably benign	Het
Sec14l5	A	G	16: 5,180,303	S509G	probably benign	Het
Sin3b	A	T	8: 72,744,508	E361V	probably benign	Het
Slc35e3	C	T	10: 117,740,890	E179K	possibly damaging	Het
Sntb2	T	C	8: 107,001,583	S388P	probably damaging	Het
Srms	A	G	2: 181,212,382	S131P	probably benign	Het
Stxbp5	T	C	10: 9,866,698		probably benign	Het
Taar2	T	C	10: 23,941,063	V167A	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Thsd7a	A	G	6: 12,321,900	Y1516H	possibly damaging	Het
Tlk1	T	A	2: 70,714,169		probably benign	Het
Tmem173	A	T	18: 35,739,088	F120L	probably benign	Het
Tnfaip3	T	C	10: 19,002,747	K771R	probably damaging	Het
Treml1	C	T	17: 48,360,458	L124F	probably damaging	Het
Ttn	G	T	2: 76,780,797	Q9137K	possibly damaging	Het
Unkl	T	A	17: 25,230,711	I469N	probably damaging	Het
Vmn1r173	G	T	7: 23,703,083	V248L	possibly damaging	Het
Vps35	T	C	8: 85,273,575	Q474R	probably damaging	Het
Wdr17	T	A	8: 54,663,008	T580S	probably benign	Het
Xpnpep1	T	C	19: 53,010,152	K222E	probably benign	Het
Ylpm1	A	G	12: 85,049,737	T1446A	probably benign	Het
Zfp277	A	G	12: 40,364,162	L228S	possibly damaging	Het
Zfp941	T	A	7: 140,813,275	K57M	probably damaging	Het
Zmpste24	A	T	4: 121,081,209	S244R	probably benign	Het

Other mutations in Fbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Fbn1	APN	2	125324947	missense	probably damaging	1.00
IGL00159:Fbn1	APN	2	125397873	missense	probably benign	0.14
IGL00500:Fbn1	APN	2	125317516	missense	probably damaging	0.99
IGL00558:Fbn1	APN	2	125329128	splice site	probably benign
IGL00645:Fbn1	APN	2	125317103	splice site	probably benign
IGL00863:Fbn1	APN	2	125403219	missense	possibly damaging	0.84
IGL00926:Fbn1	APN	2	125319042	missense	possibly damaging	0.84
IGL00935:Fbn1	APN	2	125377910	nonsense	probably null
IGL00950:Fbn1	APN	2	125358823	missense	probably damaging	1.00
IGL01090:Fbn1	APN	2	125394776	splice site	probably benign
IGL01106:Fbn1	APN	2	125351706	missense	possibly damaging	0.55
IGL01486:Fbn1	APN	2	125389978	missense	probably benign	0.03
IGL01519:Fbn1	APN	2	125317019	missense	probably benign	0.07
IGL01585:Fbn1	APN	2	125360110	missense	probably damaging	0.98
IGL01730:Fbn1	APN	2	125312974	splice site	probably benign
IGL01793:Fbn1	APN	2	125387293	missense	possibly damaging	0.67
IGL01803:Fbn1	APN	2	125350287	missense	probably damaging	1.00
IGL01803:Fbn1	APN	2	125301725	missense	probably benign
IGL01916:Fbn1	APN	2	125315446	missense	possibly damaging	0.55
IGL02035:Fbn1	APN	2	125335362	splice site	probably null
IGL02097:Fbn1	APN	2	125363969	missense	probably damaging	1.00
IGL02233:Fbn1	APN	2	125321610	splice site	probably benign
IGL02512:Fbn1	APN	2	125338460	missense	probably damaging	1.00
IGL02552:Fbn1	APN	2	125412713	missense	possibly damaging	0.86
IGL02657:Fbn1	APN	2	125352025	missense	possibly damaging	0.86
IGL02718:Fbn1	APN	2	125369886	missense	probably damaging	1.00
IGL02863:Fbn1	APN	2	125303256	missense	possibly damaging	0.80
IGL02974:Fbn1	APN	2	125346330	missense	probably null	0.99
IGL03058:Fbn1	APN	2	125403200	missense	probably benign	0.03
IGL03172:Fbn1	APN	2	125320968	missense	possibly damaging	0.92
IGL03288:Fbn1	APN	2	125303183	missense	probably benign	0.13
Carinatum	UTSW	2	125342830	missense	possibly damaging	0.70
Elasticity	UTSW	2	125403132	missense	possibly damaging	0.63
Excavatum	UTSW	2	125335487	missense	probably damaging	1.00
Exceedingly	UTSW	2	125344095	critical splice acceptor site	probably benign
Extensor	UTSW	2	125328158	missense	probably damaging	1.00
lincoln	UTSW	2	125403170	missense	possibly damaging	0.50
Long	UTSW	2	125317038	missense	probably damaging	1.00
Pectus	UTSW	2	125321691	missense	possibly damaging	0.82
Reach	UTSW	2	125382034	nonsense	probably null
reaper	UTSW	2	125315404	missense	probably damaging	0.98
Scythe	UTSW	2	125403228	missense	possibly damaging	0.84
String_bean	UTSW	2	125379134	splice site	probably null
wirey	UTSW	2	125309495	missense	probably benign
3-1:Fbn1	UTSW	2	125394605	splice site	probably benign
BB004:Fbn1	UTSW	2	125383736	missense	possibly damaging	0.82
BB014:Fbn1	UTSW	2	125383736	missense	possibly damaging	0.82
P0012:Fbn1	UTSW	2	125369321	splice site	probably benign
PIT4403001:Fbn1	UTSW	2	125342911	missense	probably damaging	1.00
PIT4466001:Fbn1	UTSW	2	125306501	missense	possibly damaging	0.90
PIT4472001:Fbn1	UTSW	2	125306501	missense	possibly damaging	0.90
PIT4651001:Fbn1	UTSW	2	125363989	critical splice acceptor site	probably null
R0310:Fbn1	UTSW	2	125363644	missense	probably damaging	1.00
R0362:Fbn1	UTSW	2	125309777	missense	probably damaging	0.99
R0374:Fbn1	UTSW	2	125321676	missense	possibly damaging	0.86
R0433:Fbn1	UTSW	2	125348215	missense	possibly damaging	0.95
R0441:Fbn1	UTSW	2	125309755	critical splice donor site	probably null
R0501:Fbn1	UTSW	2	125301749	missense	probably benign	0.23
R0510:Fbn1	UTSW	2	125342925	splice site	probably benign
R0573:Fbn1	UTSW	2	125389249	missense	probably damaging	0.99
R0622:Fbn1	UTSW	2	125379024	missense	possibly damaging	0.88
R0630:Fbn1	UTSW	2	125394770	missense	possibly damaging	0.48
R0724:Fbn1	UTSW	2	125352064	missense	probably benign	0.14
R0739:Fbn1	UTSW	2	125367630	missense	probably benign	0.18
R0744:Fbn1	UTSW	2	125314814	splice site	probably benign
R0811:Fbn1	UTSW	2	125403170	missense	possibly damaging	0.50
R0812:Fbn1	UTSW	2	125403170	missense	possibly damaging	0.50
R0862:Fbn1	UTSW	2	125342891	nonsense	probably null
R0864:Fbn1	UTSW	2	125342891	nonsense	probably null
R1061:Fbn1	UTSW	2	125345963	missense	probably benign	0.01
R1126:Fbn1	UTSW	2	125321192	splice site	probably null
R1172:Fbn1	UTSW	2	125394687	missense	probably benign	0.13
R1175:Fbn1	UTSW	2	125394687	missense	probably benign	0.13
R1183:Fbn1	UTSW	2	125321617	missense	probably benign	0.07
R1218:Fbn1	UTSW	2	125412749	missense	possibly damaging	0.71
R1241:Fbn1	UTSW	2	125372527	splice site	probably benign
R1248:Fbn1	UTSW	2	125301609	missense	probably benign	0.01
R1345:Fbn1	UTSW	2	125314671	missense	probably damaging	1.00
R1374:Fbn1	UTSW	2	125346434	missense	probably damaging	0.99
R1458:Fbn1	UTSW	2	125301929	missense	probably benign	0.01
R1474:Fbn1	UTSW	2	125361265	missense	possibly damaging	0.72
R1496:Fbn1	UTSW	2	125309495	missense	probably benign
R1502:Fbn1	UTSW	2	125363706	nonsense	probably null
R1511:Fbn1	UTSW	2	125306285	missense	probably benign	0.00
R1588:Fbn1	UTSW	2	125319114	missense	probably benign	0.19
R1626:Fbn1	UTSW	2	125341279	missense	probably damaging	1.00
R1676:Fbn1	UTSW	2	125309781	missense	probably damaging	1.00
R1712:Fbn1	UTSW	2	125346434	missense	probably damaging	0.99
R1772:Fbn1	UTSW	2	125403228	missense	possibly damaging	0.84
R1776:Fbn1	UTSW	2	125321734	missense	possibly damaging	0.71
R1869:Fbn1	UTSW	2	125352027	missense	probably benign	0.00
R1894:Fbn1	UTSW	2	125394621	missense	probably damaging	0.96
R1925:Fbn1	UTSW	2	125363629	missense	probably damaging	1.00
R1957:Fbn1	UTSW	2	125367654	missense	possibly damaging	0.93
R1995:Fbn1	UTSW	2	125350373	critical splice acceptor site	probably null
R2140:Fbn1	UTSW	2	125343810	missense	probably damaging	1.00
R2142:Fbn1	UTSW	2	125412708	missense	possibly damaging	0.93
R2268:Fbn1	UTSW	2	125321741	missense	possibly damaging	0.49
R3409:Fbn1	UTSW	2	125412665	missense	possibly damaging	0.92
R3418:Fbn1	UTSW	2	125320926	missense	possibly damaging	0.55
R3508:Fbn1	UTSW	2	125306327	missense	probably benign	0.19
R3778:Fbn1	UTSW	2	125317086	missense	probably damaging	1.00
R3800:Fbn1	UTSW	2	125345974	missense	possibly damaging	0.63
R4001:Fbn1	UTSW	2	125477495	critical splice donor site	probably null
R4169:Fbn1	UTSW	2	125363952	missense	possibly damaging	0.86
R4398:Fbn1	UTSW	2	125397781	missense	probably benign	0.32
R4482:Fbn1	UTSW	2	125363610	critical splice donor site	probably null
R4559:Fbn1	UTSW	2	125351714	missense	possibly damaging	0.65
R4608:Fbn1	UTSW	2	125306500	missense	probably benign	0.05
R4634:Fbn1	UTSW	2	125344061	missense	probably damaging	1.00
R4706:Fbn1	UTSW	2	125370149	missense	probably benign	0.21
R4712:Fbn1	UTSW	2	125341316	missense	probably benign	0.12
R4783:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4784:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4785:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4793:Fbn1	UTSW	2	125321235	nonsense	probably null
R4838:Fbn1	UTSW	2	125372399	missense	probably benign	0.01
R4864:Fbn1	UTSW	2	125372397	missense	possibly damaging	0.92
R4887:Fbn1	UTSW	2	125309774	missense	probably damaging	1.00
R4942:Fbn1	UTSW	2	125383616	missense	possibly damaging	0.88
R4952:Fbn1	UTSW	2	125317534	missense	probably damaging	1.00
R5030:Fbn1	UTSW	2	125412704	missense	possibly damaging	0.51
R5044:Fbn1	UTSW	2	125329102	missense	probably damaging	0.97
R5057:Fbn1	UTSW	2	125466695	missense	probably benign	0.33
R5115:Fbn1	UTSW	2	125332383	missense	probably damaging	1.00
R5399:Fbn1	UTSW	2	125332333	missense	possibly damaging	0.69
R5498:Fbn1	UTSW	2	125360176	missense	probably damaging	1.00
R5526:Fbn1	UTSW	2	125365639	missense	possibly damaging	0.83
R5529:Fbn1	UTSW	2	125373950	missense	probably benign	0.01
R5602:Fbn1	UTSW	2	125321741	missense	possibly damaging	0.49
R5760:Fbn1	UTSW	2	125361247	missense	probably damaging	1.00
R5837:Fbn1	UTSW	2	125379134	splice site	probably null
R5955:Fbn1	UTSW	2	125358882	missense	probably damaging	1.00
R5980:Fbn1	UTSW	2	125315404	missense	probably damaging	0.98
R6039:Fbn1	UTSW	2	125363880	missense	probably damaging	1.00
R6039:Fbn1	UTSW	2	125363880	missense	probably damaging	1.00
R6058:Fbn1	UTSW	2	125466612	missense	possibly damaging	0.73
R6089:Fbn1	UTSW	2	125321225	missense	possibly damaging	0.55
R6136:Fbn1	UTSW	2	125403132	missense	possibly damaging	0.63
R6161:Fbn1	UTSW	2	125369801	nonsense	probably null
R6162:Fbn1	UTSW	2	125360227	missense	probably damaging	1.00
R6165:Fbn1	UTSW	2	125332363	missense	probably damaging	0.99
R6169:Fbn1	UTSW	2	125335489	critical splice acceptor site	probably null
R6221:Fbn1	UTSW	2	125320921	missense	probably benign	0.07
R6223:Fbn1	UTSW	2	125412671	missense	possibly damaging	0.86
R6225:Fbn1	UTSW	2	125330543	missense	probably damaging	1.00
R6238:Fbn1	UTSW	2	125324945	missense	probably damaging	0.98
R6329:Fbn1	UTSW	2	125308473	missense	possibly damaging	0.70
R6401:Fbn1	UTSW	2	125346450	missense	probably damaging	0.98
R6480:Fbn1	UTSW	2	125335418	missense	probably benign	0.05
R6513:Fbn1	UTSW	2	125383671	missense	probably damaging	1.00
R6530:Fbn1	UTSW	2	125389270	missense	probably damaging	0.99
R6595:Fbn1	UTSW	2	125342830	missense	possibly damaging	0.70
R6781:Fbn1	UTSW	2	125317038	missense	probably damaging	1.00
R6849:Fbn1	UTSW	2	125321691	missense	possibly damaging	0.82
R6860:Fbn1	UTSW	2	125328158	missense	probably damaging	1.00
R6960:Fbn1	UTSW	2	125382060	missense	probably benign	0.16
R7134:Fbn1	UTSW	2	125382049	missense	probably benign	0.03
R7241:Fbn1	UTSW	2	125306495	missense	possibly damaging	0.86
R7295:Fbn1	UTSW	2	125335487	missense	probably damaging	1.00
R7312:Fbn1	UTSW	2	125466674	missense	possibly damaging	0.53
R7322:Fbn1	UTSW	2	125479195	missense	possibly damaging	0.92
R7349:Fbn1	UTSW	2	125315401	missense	possibly damaging	0.84
R7365:Fbn1	UTSW	2	125352049	missense	probably damaging	0.97
R7392:Fbn1	UTSW	2	125343924	missense	probably damaging	1.00
R7442:Fbn1	UTSW	2	125403212	missense	possibly damaging	0.45
R7452:Fbn1	UTSW	2	125505455	missense	possibly damaging	0.53
R7453:Fbn1	UTSW	2	125320959	missense	possibly damaging	0.93
R7457:Fbn1	UTSW	2	125351747	missense	possibly damaging	0.90
R7458:Fbn1	UTSW	2	125319116	missense	probably benign	0.14
R7549:Fbn1	UTSW	2	125344027	missense	probably damaging	0.99
R7570:Fbn1	UTSW	2	125397852	missense	probably benign	0.29
R7666:Fbn1	UTSW	2	125306471	missense	probably damaging	1.00
R7723:Fbn1	UTSW	2	125382034	nonsense	probably null
R7745:Fbn1	UTSW	2	125303195	missense	probably benign	0.06
R7754:Fbn1	UTSW	2	125479280	splice site	probably null
R7780:Fbn1	UTSW	2	125301758	missense	probably benign	0.15
R7849:Fbn1	UTSW	2	125309485	missense	probably damaging	0.98
R7927:Fbn1	UTSW	2	125383736	missense	possibly damaging	0.82
R7942:Fbn1	UTSW	2	125412786	missense	possibly damaging	0.53
R7948:Fbn1	UTSW	2	125341299	missense	probably damaging	1.00
R7985:Fbn1	UTSW	2	125301878	missense	probably benign	0.01
R8051:Fbn1	UTSW	2	125306463	missense	possibly damaging	0.86
R8054:Fbn1	UTSW	2	125346018	missense	possibly damaging	0.93
R8058:Fbn1	UTSW	2	125351969	missense	possibly damaging	0.46
R8113:Fbn1	UTSW	2	125477569	missense	probably damaging	1.00
R8307:Fbn1	UTSW	2	125505482	missense	possibly damaging	0.53
R8472:Fbn1	UTSW	2	125309802	missense	probably damaging	1.00
R8690:Fbn1	UTSW	2	125344095	critical splice acceptor site	probably benign
R8724:Fbn1	UTSW	2	125360146	missense	probably damaging	0.98
R8856:Fbn1	UTSW	2	125314717	missense	probably damaging	1.00
R8916:Fbn1	UTSW	2	125403229	missense	possibly damaging	0.63
R8931:Fbn1	UTSW	2	125360175	missense	probably damaging	1.00
R8988:Fbn1	UTSW	2	125370806	missense	possibly damaging	0.88
R9127:Fbn1	UTSW	2	125382065	missense	possibly damaging	0.86
R9161:Fbn1	UTSW	2	125350350	missense	probably damaging	1.00
R9495:Fbn1	UTSW	2	125319064	missense	probably damaging	0.96
R9515:Fbn1	UTSW	2	125365631	missense	probably benign	0.03
R9557:Fbn1	UTSW	2	125338538	missense	probably damaging	0.99
R9597:Fbn1	UTSW	2	125345986	missense	probably benign
R9680:Fbn1	UTSW	2	125468564	missense	probably benign	0.29
R9723:Fbn1	UTSW	2	125360199	nonsense	probably null
R9734:Fbn1	UTSW	2	125389978	missense	probably benign	0.03
R9796:Fbn1	UTSW	2	125317021	missense	probably benign	0.19
X0019:Fbn1	UTSW	2	125383643	missense	possibly damaging	0.82
X0020:Fbn1	UTSW	2	125369340	missense	probably damaging	1.00
X0028:Fbn1	UTSW	2	125342798	critical splice donor site	probably null
X0067:Fbn1	UTSW	2	125369914	missense	possibly damaging	0.95
Z1088:Fbn1	UTSW	2	125350288	missense	probably damaging	0.99
Z1176:Fbn1	UTSW	2	125387350	missense	possibly damaging	0.51
Z1177:Fbn1	UTSW	2	125389231	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCAGTGGAGGAACAGAACATGAC -3'
(R):5'- CTGATGACTCAGCAGTTGGTGAGTG -3'

Sequencing Primer
(F):5'- AGAACATGACTCGTACCTTGG -3'
(R):5'- AGTGCCCAGCTAGGTCTTC -3'

Posted On

2013-05-09