Incidental Mutation 'R0226:Agl'
ID 33906
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Name amylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms 9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission 038471-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R0226 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 116739999-116808166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 116752071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1359 (R1359C)
Ref Sequence ENSEMBL: ENSMUSP00000124149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
AlphaFold F8VPN4
Predicted Effect probably damaging
Transcript: ENSMUST00000040603
AA Change: R1359C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: R1359C

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159742
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160484
AA Change: R694C
SMART Domains Protein: ENSMUSP00000123985
Gene: ENSMUSG00000033400
AA Change: R694C

DomainStartEndE-ValueType
Pfam:hGDE_central 33 310 2.8e-87 PFAM
Pfam:GDE_C 379 830 1.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162792
AA Change: R1359C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: R1359C

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Meta Mutation Damage Score 0.3732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
ANU05:Agl UTSW 3 116772789 missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2004:Agl UTSW 3 116781265 missense probably damaging 1.00
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4181:Agl UTSW 3 116746630 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5219:Agl UTSW 3 116778721 missense possibly damaging 0.81
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5511:Agl UTSW 3 116788560 missense possibly damaging 0.81
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R5986:Agl UTSW 3 116772496 missense probably damaging 1.00
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7259:Agl UTSW 3 116784581 missense probably damaging 1.00
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
R7587:Agl UTSW 3 116792087 missense probably damaging 1.00
R7609:Agl UTSW 3 116807279 missense possibly damaging 0.93
R7657:Agl UTSW 3 116779163 missense
R7715:Agl UTSW 3 116758256 missense
R7735:Agl UTSW 3 116785146 missense probably benign 0.21
R7770:Agl UTSW 3 116758237 critical splice donor site probably null
R7980:Agl UTSW 3 116792181 missense probably benign 0.08
R8186:Agl UTSW 3 116758908 missense possibly damaging 0.92
R8215:Agl UTSW 3 116788644 missense probably damaging 1.00
R8336:Agl UTSW 3 116772846 missense
R8709:Agl UTSW 3 116772472 missense
R9545:Agl UTSW 3 116788689 missense possibly damaging 0.96
X0065:Agl UTSW 3 116781330 nonsense probably null
Z1177:Agl UTSW 3 116781036 missense
Predicted Primers PCR Primer
(F):5'- AGACGCCAGGTACTGGGCAT -3'
(R):5'- GCATATCTCCATCTAAAGCAGCCACATT -3'

Sequencing Primer
(F):5'- ACTGGGCATGTGTGACTC -3'
(R):5'- GCAGCCACATTTTCTAAAACATAG -3'
Posted On 2013-05-09