Incidental Mutation 'R0226:Aasdh'
ID 33914
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.158) question?
Stock # R0226 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77021506-77053361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77049849 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 49 (L49Q)
Ref Sequence ENSEMBL: ENSMUSP00000117639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000135954] [ENSMUST00000146570] [ENSMUST00000142450]
AlphaFold Q80WC9
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: L49Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: L49Q

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: L49Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: L49Q

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000123682
AA Change: L49Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923
AA Change: L49Q

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126741
AA Change: L49Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: L49Q

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect probably benign
Transcript: ENSMUST00000135954
Predicted Effect probably damaging
Transcript: ENSMUST00000146570
AA Change: L49Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: L49Q

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136080
Predicted Effect probably benign
Transcript: ENSMUST00000142450
Meta Mutation Damage Score 0.7101 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Ablim1 A T 19: 57,032,302 (GRCm39) L556Q probably damaging Het
Afdn A G 17: 14,119,408 (GRCm39) T1700A probably benign Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Agpat3 T A 10: 78,113,863 (GRCm39) H275L possibly damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Aim2 A G 1: 173,289,899 (GRCm39) probably benign Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fbn1 C T 2: 125,162,830 (GRCm39) R2152Q possibly damaging Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Rnf43 A T 11: 87,622,263 (GRCm39) S455C probably damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Treml1 C T 17: 48,667,486 (GRCm39) L124F probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp277 A G 12: 40,414,161 (GRCm39) L228S possibly damaging Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 77,026,381 (GRCm39) unclassified probably benign
IGL01013:Aasdh APN 5 77,034,053 (GRCm39) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 77,036,464 (GRCm39) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 77,049,961 (GRCm39) missense probably benign 0.27
IGL02614:Aasdh APN 5 77,044,215 (GRCm39) splice site probably benign
IGL02678:Aasdh APN 5 77,035,867 (GRCm39) splice site probably benign
IGL02739:Aasdh APN 5 77,026,364 (GRCm39) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 77,049,957 (GRCm39) missense probably benign 0.01
IGL03116:Aasdh APN 5 77,049,936 (GRCm39) splice site probably null
IGL03398:Aasdh APN 5 77,039,566 (GRCm39) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 77,044,464 (GRCm39) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 77,034,082 (GRCm39) missense probably benign 0.05
R0367:Aasdh UTSW 5 77,049,961 (GRCm39) missense probably damaging 0.99
R0386:Aasdh UTSW 5 77,044,308 (GRCm39) missense probably damaging 0.98
R0529:Aasdh UTSW 5 77,024,114 (GRCm39) nonsense probably null
R0881:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R0882:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1033:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1034:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1035:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1036:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1366:Aasdh UTSW 5 77,036,651 (GRCm39) missense probably benign 0.10
R1446:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1449:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1583:Aasdh UTSW 5 77,030,528 (GRCm39) missense probably benign 0.00
R1641:Aasdh UTSW 5 77,039,626 (GRCm39) missense probably benign 0.36
R1876:Aasdh UTSW 5 77,025,396 (GRCm39) missense probably damaging 1.00
R1895:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R1946:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R3615:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3616:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3746:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3747:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3748:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3750:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3836:Aasdh UTSW 5 77,026,315 (GRCm39) missense probably benign 0.32
R4857:Aasdh UTSW 5 77,035,131 (GRCm39) missense probably benign 0.01
R4928:Aasdh UTSW 5 77,044,535 (GRCm39) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R5762:Aasdh UTSW 5 77,044,445 (GRCm39) missense probably benign 0.00
R5866:Aasdh UTSW 5 77,024,058 (GRCm39) missense probably damaging 1.00
R5940:Aasdh UTSW 5 77,030,745 (GRCm39) missense probably benign 0.07
R6253:Aasdh UTSW 5 77,034,105 (GRCm39) missense possibly damaging 0.81
R6542:Aasdh UTSW 5 77,030,902 (GRCm39) missense probably damaging 1.00
R6825:Aasdh UTSW 5 77,036,696 (GRCm39) splice site probably null
R6868:Aasdh UTSW 5 77,039,527 (GRCm39) missense probably damaging 0.99
R6876:Aasdh UTSW 5 77,044,288 (GRCm39) missense probably damaging 1.00
R6961:Aasdh UTSW 5 77,024,148 (GRCm39) missense probably damaging 1.00
R6963:Aasdh UTSW 5 77,044,303 (GRCm39) missense probably damaging 0.99
R7069:Aasdh UTSW 5 77,024,203 (GRCm39) missense probably benign 0.03
R7220:Aasdh UTSW 5 77,049,772 (GRCm39) missense probably benign 0.13
R7545:Aasdh UTSW 5 77,027,861 (GRCm39) missense probably damaging 1.00
R7673:Aasdh UTSW 5 77,030,555 (GRCm39) missense probably benign 0.03
R7703:Aasdh UTSW 5 77,035,924 (GRCm39) missense probably damaging 0.99
R7890:Aasdh UTSW 5 77,031,969 (GRCm39) missense probably benign 0.19
R7978:Aasdh UTSW 5 77,036,515 (GRCm39) missense probably damaging 0.99
R8046:Aasdh UTSW 5 77,044,325 (GRCm39) missense probably benign
R8152:Aasdh UTSW 5 77,044,305 (GRCm39) missense probably damaging 1.00
R8425:Aasdh UTSW 5 77,034,124 (GRCm39) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 77,039,641 (GRCm39) missense possibly damaging 0.94
R9028:Aasdh UTSW 5 77,023,977 (GRCm39) missense probably damaging 1.00
R9361:Aasdh UTSW 5 77,030,225 (GRCm39) missense probably benign 0.01
R9519:Aasdh UTSW 5 77,030,572 (GRCm39) missense probably benign 0.00
Z1088:Aasdh UTSW 5 77,049,004 (GRCm39) splice site probably null
Z1176:Aasdh UTSW 5 77,039,643 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGAATGACAGCTCAATGGTTTGTTTG -3'
(R):5'- CCTGACAACTCCCCTAACGTTTGAC -3'

Sequencing Primer
(F):5'- ACTTTTAGTCTGTCCTTAATAAGCTC -3'
(R):5'- GTGTAGATTTCTCAGCCACCAATG -3'
Posted On 2013-05-09