Mutagenetix > Incidental Mutations

Incidental Mutation 'R0226:Thsd7a'

33916

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

038471-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0226 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12321900 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1516 (Y1516H)

Ref Sequence

ENSEMBL: ENSMUSP00000131662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046121
AA Change: Y1516H

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: Y1516H

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.2e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119581
AA Change: Y1516H

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: Y1516H

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122369

SMART Domains

Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	43	100	6.24e-6	SMART
TSP1	178	228	7.31e-2	SMART
Blast:TSP1	232	302	4e-26	BLAST
TSP1	307	362	9.09e-8	SMART
TSP1	365	430	5.82e-1	SMART
TSP1	435	487	4.24e-2	SMART
TSP1	490	551	1e0	SMART
TSP1	556	608	3.55e-10	SMART
TSP1	609	679	7.5e-2	SMART
TSP1	684	742	1.55e-1	SMART
transmembrane domain	874	896	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135450

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137836

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172356
AA Change: Y1516H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: Y1516H

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Meta Mutation Damage Score

0.0663

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	G	T	14: 59,142,120	T54K	possibly damaging	Het
2210408I21Rik	A	T	13: 77,303,425	E876V	possibly damaging	Het
Aasdh	A	T	5: 76,902,002	L49Q	probably damaging	Het
Abca8b	T	C	11: 109,957,018		probably null	Het
Ablim1	A	T	19: 57,043,870	L556Q	probably damaging	Het
Afdn	A	G	17: 13,899,146	T1700A	probably benign	Het
Agl	G	A	3: 116,752,071	R1359C	probably damaging	Het
Agpat3	T	A	10: 78,278,029	H275L	possibly damaging	Het
Ahcyl1	A	T	3: 107,670,270	C180*	probably null	Het
Aim2	A	G	1: 173,462,333		probably benign	Het
Angpt1	T	C	15: 42,468,235	N320S	probably benign	Het
Ankrd52	T	A	10: 128,389,858		probably null	Het
Ap1g1	C	T	8: 109,855,062	S654L	probably benign	Het
Bpifa1	T	A	2: 154,146,057	S173R	probably benign	Het
Brd8	T	C	18: 34,603,894		probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
C1qtnf2	A	G	11: 43,490,843	T161A	probably benign	Het
Car6	T	C	4: 150,187,508	Y228C	probably damaging	Het
Ccdc149	A	G	5: 52,400,217	L273P	probably damaging	Het
Cit	G	A	5: 115,984,840	R1405Q	probably damaging	Het
Cox17	T	C	16: 38,349,276	L48P	probably damaging	Het
Cttn	A	G	7: 144,441,852		probably benign	Het
Cyp4f18	T	C	8: 71,989,775		probably benign	Het
Dtnbp1	A	G	13: 44,923,193	L175P	probably damaging	Het
Efl1	T	C	7: 82,693,011		probably benign	Het
Fbn1	C	T	2: 125,320,910	R2152Q	possibly damaging	Het
Fignl1	A	T	11: 11,801,061	S665T	probably benign	Het
Gm884	A	T	11: 103,603,241	F663L	probably benign	Het
Gm9843	A	T	16: 76,403,561		noncoding transcript	Het
Gpr155	C	T	2: 73,367,592	V395I	probably benign	Het
Greb1l	T	C	18: 10,522,076		probably benign	Het
Hdgfl1	A	T	13: 26,769,996	H31Q	probably benign	Het
Heatr1	T	C	13: 12,410,562	S628P	probably damaging	Het
Hivep2	A	G	10: 14,129,712	T685A	probably benign	Het
Hmgcl	T	G	4: 135,958,728	V168G	probably damaging	Het
Itch	T	C	2: 155,199,394	I454T	probably benign	Het
Itih2	T	C	2: 10,115,299	D309G	possibly damaging	Het
Kcmf1	T	C	6: 72,842,952	I304V	probably benign	Het
Kcnh1	G	A	1: 192,276,804	W222*	probably null	Het
Kcnh1	G	T	1: 192,276,805	W222C	probably damaging	Het
Kif24	T	A	4: 41,414,939	K287*	probably null	Het
Lrig3	A	G	10: 125,972,117		probably benign	Het
Lrp2	A	T	2: 69,537,563	C202S	probably null	Het
Lrrn2	A	G	1: 132,937,820	N208D	probably damaging	Het
Mcm5	C	T	8: 75,126,252	T664I	possibly damaging	Het
Mfsd10	A	G	5: 34,634,446	L365S	probably benign	Het
Mfsd6	A	G	1: 52,658,690		probably benign	Het
Mgat4e	A	G	1: 134,541,103	V401A	probably benign	Het
Mllt3	C	A	4: 87,840,732	V360L	probably benign	Het
Mrm1	G	A	11: 84,819,170	A68V	possibly damaging	Het
Myo19	A	G	11: 84,897,732		probably benign	Het
Myo3b	A	G	2: 70,217,166	T311A	probably benign	Het
Myo5b	T	C	18: 74,742,180	F1552L	probably benign	Het
Myo7b	C	T	18: 31,972,896	V1353I	probably benign	Het
Myo9b	T	C	8: 71,353,832	S1512P	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Osbpl3	A	G	6: 50,353,008	W63R	probably damaging	Het
Pcdh17	T	C	14: 84,448,201	S703P	probably damaging	Het
Pclo	T	C	5: 14,765,223	I1231T	probably damaging	Het
Pex16	A	C	2: 92,375,687		probably benign	Het
Pfkl	T	C	10: 77,992,534	N399S	probably benign	Het
Pkhd1l1	G	A	15: 44,526,784	R1432K	possibly damaging	Het
Prdm1	T	A	10: 44,456,696	T106S	probably benign	Het
Prrc1	A	G	18: 57,363,291	M105V	probably benign	Het
Psg26	A	G	7: 18,483,958	C12R	possibly damaging	Het
Rnf43	A	T	11: 87,731,437	S455C	probably damaging	Het
Ryr2	T	C	13: 11,772,556	K977R	probably damaging	Het
Sart1	C	T	19: 5,381,122		probably benign	Het
Sec14l5	A	G	16: 5,180,303	S509G	probably benign	Het
Sin3b	A	T	8: 72,744,508	E361V	probably benign	Het
Slc35e3	C	T	10: 117,740,890	E179K	possibly damaging	Het
Sntb2	T	C	8: 107,001,583	S388P	probably damaging	Het
Srms	A	G	2: 181,212,382	S131P	probably benign	Het
Stxbp5	T	C	10: 9,866,698		probably benign	Het
Taar2	T	C	10: 23,941,063	V167A	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tlk1	T	A	2: 70,714,169		probably benign	Het
Tmem173	A	T	18: 35,739,088	F120L	probably benign	Het
Tnfaip3	T	C	10: 19,002,747	K771R	probably damaging	Het
Treml1	C	T	17: 48,360,458	L124F	probably damaging	Het
Ttn	G	T	2: 76,780,797	Q9137K	possibly damaging	Het
Unkl	T	A	17: 25,230,711	I469N	probably damaging	Het
Vmn1r173	G	T	7: 23,703,083	V248L	possibly damaging	Het
Vps35	T	C	8: 85,273,575	Q474R	probably damaging	Het
Wdr17	T	A	8: 54,663,008	T580S	probably benign	Het
Xpnpep1	T	C	19: 53,010,152	K222E	probably benign	Het
Ylpm1	A	G	12: 85,049,737	T1446A	probably benign	Het
Zfp277	A	G	12: 40,364,162	L228S	possibly damaging	Het
Zfp941	T	A	7: 140,813,275	K57M	probably damaging	Het
Zmpste24	A	T	4: 121,081,209	S244R	probably benign	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
G1patch:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0755:Thsd7a	UTSW	6	12555369	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12555702	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12471175	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12321041	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4668:Thsd7a	UTSW	6	12408968	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12327602	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6273:Thsd7a	UTSW	6	12408836	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense
R7869:Thsd7a	UTSW	6	12471124	nonsense	probably null
R8032:Thsd7a	UTSW	6	12555288	missense
R8165:Thsd7a	UTSW	6	12468963	missense
R8167:Thsd7a	UTSW	6	12317401	nonsense	probably null
R8245:Thsd7a	UTSW	6	12379593	missense
R8310:Thsd7a	UTSW	6	12396613	missense
R8312:Thsd7a	UTSW	6	12471182	missense
R8331:Thsd7a	UTSW	6	12471158	missense
R8755:Thsd7a	UTSW	6	12408852	nonsense	probably null
R8843:Thsd7a	UTSW	6	12501137	missense
R8867:Thsd7a	UTSW	6	12338687	missense
R8952:Thsd7a	UTSW	6	12468993	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTTAACTCTGCCTCCCCATGCTAAG -3'
(R):5'- CCAGCCATTTCACAAATGCAGTACTTC -3'

Sequencing Primer
(F):5'- CCATGCTAAGTCTTTCTAACGG -3'
(R):5'- GCAGTACTTCTTAGAACTTCCAAAGG -3'

Posted On

2013-05-09