Incidental Mutation 'R0226:Kcmf1'
ID33918
Institutional Source Beutler Lab
Gene Symbol Kcmf1
Ensembl Gene ENSMUSG00000055239
Gene Namepotassium channel modulatory factor 1
Synonyms1700094M07Rik, clone DEBT-91, Pmcf
MMRRC Submission 038471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0226 (G1)
Quality Score201
Status Validated
Chromosome6
Chromosomal Location72841114-72899979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72842952 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 304 (I304V)
Ref Sequence ENSEMBL: ENSMUSP00000144910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068697] [ENSMUST00000204598] [ENSMUST00000206378]
Predicted Effect probably benign
Transcript: ENSMUST00000068697
AA Change: I355V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064410
Gene: ENSMUSG00000055239
AA Change: I355V

DomainStartEndE-ValueType
ZnF_ZZ 3 48 6.05e-14 SMART
ZnF_C2H2 78 101 3.16e-3 SMART
low complexity region 157 168 N/A INTRINSIC
low complexity region 175 192 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 331 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203004
Predicted Effect probably benign
Transcript: ENSMUST00000204598
AA Change: I304V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144910
Gene: ENSMUSG00000055239
AA Change: I304V

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.4e-5 SMART
Blast:ZnF_C2H2 57 85 9e-6 BLAST
low complexity region 106 117 N/A INTRINSIC
low complexity region 124 141 N/A INTRINSIC
coiled coil region 173 208 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206378
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit some perinatal and postnatal lethality but mice that survive to adulthood exhibit normal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Kcmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02903:Kcmf1 APN 6 72858883 missense possibly damaging 0.95
IGL03057:Kcmf1 APN 6 72843027 missense probably benign 0.02
IGL03372:Kcmf1 APN 6 72849563 missense probably damaging 0.99
IGL03098:Kcmf1 UTSW 6 72849584 start codon destroyed probably null
R0080:Kcmf1 UTSW 6 72850487 splice site probably null
R0082:Kcmf1 UTSW 6 72850487 splice site probably null
R0402:Kcmf1 UTSW 6 72849585 start codon destroyed probably null
R0412:Kcmf1 UTSW 6 72848241 nonsense probably null
R0616:Kcmf1 UTSW 6 72850484 missense probably benign 0.08
R1087:Kcmf1 UTSW 6 72858880 missense probably damaging 1.00
R1383:Kcmf1 UTSW 6 72849582 missense possibly damaging 0.94
R1533:Kcmf1 UTSW 6 72843020 missense possibly damaging 0.49
R1544:Kcmf1 UTSW 6 72848229 missense probably benign
R2355:Kcmf1 UTSW 6 72850483 missense probably damaging 1.00
R2380:Kcmf1 UTSW 6 72858772 critical splice donor site probably null
R3103:Kcmf1 UTSW 6 72861847 missense probably damaging 1.00
R4533:Kcmf1 UTSW 6 72849591 missense probably damaging 1.00
R5450:Kcmf1 UTSW 6 72842930 nonsense probably null
R5927:Kcmf1 UTSW 6 72843005 missense possibly damaging 0.49
R6467:Kcmf1 UTSW 6 72843099 missense probably damaging 0.99
R7048:Kcmf1 UTSW 6 72849467 missense probably damaging 1.00
R7089:Kcmf1 UTSW 6 72842946 missense probably benign 0.26
R7089:Kcmf1 UTSW 6 72848306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCTTTTGCATGTCAAGGTACAGG -3'
(R):5'- GTTGAGGTCACCAAACAAAGCGTC -3'

Sequencing Primer
(F):5'- GCTACCTACATTTACCTGCTAGAAG -3'
(R):5'- GCAGACTATAGAACTTGGCCTCG -3'
Posted On2013-05-09