Mutagenetix > Incidental Mutations

Incidental Mutation 'R0226:Vps35'

33931

Institutional Source

Beutler Lab

Gene Symbol

Vps35

Ensembl Gene

ENSMUSG00000031696

Gene Name

VPS35 retromer complex component

Synonyms

Mem3

MMRRC Submission

038471-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0226 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85260392-85299802 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85273575 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 474 (Q474R)

Ref Sequence

ENSEMBL: ENSMUSP00000034131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034131]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034131
AA Change: Q474R

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696
AA Change: Q474R

Domain	Start	End	E-Value	Type
Pfam:Vps35	15	753	6.8e-303	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209277

Meta Mutation Damage Score

0.5879

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	G	T	14: 59,142,120	T54K	possibly damaging	Het
2210408I21Rik	A	T	13: 77,303,425	E876V	possibly damaging	Het
Aasdh	A	T	5: 76,902,002	L49Q	probably damaging	Het
Abca8b	T	C	11: 109,957,018		probably null	Het
Ablim1	A	T	19: 57,043,870	L556Q	probably damaging	Het
Afdn	A	G	17: 13,899,146	T1700A	probably benign	Het
Agl	G	A	3: 116,752,071	R1359C	probably damaging	Het
Agpat3	T	A	10: 78,278,029	H275L	possibly damaging	Het
Ahcyl1	A	T	3: 107,670,270	C180*	probably null	Het
Aim2	A	G	1: 173,462,333		probably benign	Het
Angpt1	T	C	15: 42,468,235	N320S	probably benign	Het
Ankrd52	T	A	10: 128,389,858		probably null	Het
Ap1g1	C	T	8: 109,855,062	S654L	probably benign	Het
Bpifa1	T	A	2: 154,146,057	S173R	probably benign	Het
Brd8	T	C	18: 34,603,894		probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
C1qtnf2	A	G	11: 43,490,843	T161A	probably benign	Het
Car6	T	C	4: 150,187,508	Y228C	probably damaging	Het
Ccdc149	A	G	5: 52,400,217	L273P	probably damaging	Het
Cit	G	A	5: 115,984,840	R1405Q	probably damaging	Het
Cox17	T	C	16: 38,349,276	L48P	probably damaging	Het
Cttn	A	G	7: 144,441,852		probably benign	Het
Cyp4f18	T	C	8: 71,989,775		probably benign	Het
Dtnbp1	A	G	13: 44,923,193	L175P	probably damaging	Het
Efl1	T	C	7: 82,693,011		probably benign	Het
Fbn1	C	T	2: 125,320,910	R2152Q	possibly damaging	Het
Fignl1	A	T	11: 11,801,061	S665T	probably benign	Het
Gm884	A	T	11: 103,603,241	F663L	probably benign	Het
Gm9843	A	T	16: 76,403,561		noncoding transcript	Het
Gpr155	C	T	2: 73,367,592	V395I	probably benign	Het
Greb1l	T	C	18: 10,522,076		probably benign	Het
Hdgfl1	A	T	13: 26,769,996	H31Q	probably benign	Het
Heatr1	T	C	13: 12,410,562	S628P	probably damaging	Het
Hivep2	A	G	10: 14,129,712	T685A	probably benign	Het
Hmgcl	T	G	4: 135,958,728	V168G	probably damaging	Het
Itch	T	C	2: 155,199,394	I454T	probably benign	Het
Itih2	T	C	2: 10,115,299	D309G	possibly damaging	Het
Kcmf1	T	C	6: 72,842,952	I304V	probably benign	Het
Kcnh1	G	A	1: 192,276,804	W222*	probably null	Het
Kcnh1	G	T	1: 192,276,805	W222C	probably damaging	Het
Kif24	T	A	4: 41,414,939	K287*	probably null	Het
Lrig3	A	G	10: 125,972,117		probably benign	Het
Lrp2	A	T	2: 69,537,563	C202S	probably null	Het
Lrrn2	A	G	1: 132,937,820	N208D	probably damaging	Het
Mcm5	C	T	8: 75,126,252	T664I	possibly damaging	Het
Mfsd10	A	G	5: 34,634,446	L365S	probably benign	Het
Mfsd6	A	G	1: 52,658,690		probably benign	Het
Mgat4e	A	G	1: 134,541,103	V401A	probably benign	Het
Mllt3	C	A	4: 87,840,732	V360L	probably benign	Het
Mrm1	G	A	11: 84,819,170	A68V	possibly damaging	Het
Myo19	A	G	11: 84,897,732		probably benign	Het
Myo3b	A	G	2: 70,217,166	T311A	probably benign	Het
Myo5b	T	C	18: 74,742,180	F1552L	probably benign	Het
Myo7b	C	T	18: 31,972,896	V1353I	probably benign	Het
Myo9b	T	C	8: 71,353,832	S1512P	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Osbpl3	A	G	6: 50,353,008	W63R	probably damaging	Het
Pcdh17	T	C	14: 84,448,201	S703P	probably damaging	Het
Pclo	T	C	5: 14,765,223	I1231T	probably damaging	Het
Pex16	A	C	2: 92,375,687		probably benign	Het
Pfkl	T	C	10: 77,992,534	N399S	probably benign	Het
Pkhd1l1	G	A	15: 44,526,784	R1432K	possibly damaging	Het
Prdm1	T	A	10: 44,456,696	T106S	probably benign	Het
Prrc1	A	G	18: 57,363,291	M105V	probably benign	Het
Psg26	A	G	7: 18,483,958	C12R	possibly damaging	Het
Rnf43	A	T	11: 87,731,437	S455C	probably damaging	Het
Ryr2	T	C	13: 11,772,556	K977R	probably damaging	Het
Sart1	C	T	19: 5,381,122		probably benign	Het
Sec14l5	A	G	16: 5,180,303	S509G	probably benign	Het
Sin3b	A	T	8: 72,744,508	E361V	probably benign	Het
Slc35e3	C	T	10: 117,740,890	E179K	possibly damaging	Het
Sntb2	T	C	8: 107,001,583	S388P	probably damaging	Het
Srms	A	G	2: 181,212,382	S131P	probably benign	Het
Stxbp5	T	C	10: 9,866,698		probably benign	Het
Taar2	T	C	10: 23,941,063	V167A	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Thsd7a	A	G	6: 12,321,900	Y1516H	possibly damaging	Het
Tlk1	T	A	2: 70,714,169		probably benign	Het
Tmem173	A	T	18: 35,739,088	F120L	probably benign	Het
Tnfaip3	T	C	10: 19,002,747	K771R	probably damaging	Het
Treml1	C	T	17: 48,360,458	L124F	probably damaging	Het
Ttn	G	T	2: 76,780,797	Q9137K	possibly damaging	Het
Unkl	T	A	17: 25,230,711	I469N	probably damaging	Het
Vmn1r173	G	T	7: 23,703,083	V248L	possibly damaging	Het
Wdr17	T	A	8: 54,663,008	T580S	probably benign	Het
Xpnpep1	T	C	19: 53,010,152	K222E	probably benign	Het
Ylpm1	A	G	12: 85,049,737	T1446A	probably benign	Het
Zfp277	A	G	12: 40,364,162	L228S	possibly damaging	Het
Zfp941	T	A	7: 140,813,275	K57M	probably damaging	Het
Zmpste24	A	T	4: 121,081,209	S244R	probably benign	Het

Other mutations in Vps35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01745:Vps35	APN	8	85273463	splice site	probably benign
IGL02604:Vps35	APN	8	85286389	missense	probably damaging	1.00
IGL03278:Vps35	APN	8	85294961	unclassified	probably benign
IGL03326:Vps35	APN	8	85274897	nonsense	probably null
PIT4151001:Vps35	UTSW	8	85284048	missense	possibly damaging	0.95
R0118:Vps35	UTSW	8	85294953	missense	probably benign	0.04
R1079:Vps35	UTSW	8	85279054	missense	probably damaging	1.00
R1477:Vps35	UTSW	8	85287800	missense	probably damaging	1.00
R1969:Vps35	UTSW	8	85278994	missense	possibly damaging	0.90
R2082:Vps35	UTSW	8	85263465	missense	possibly damaging	0.95
R2156:Vps35	UTSW	8	85286500	missense	probably benign	0.06
R2341:Vps35	UTSW	8	85274814	splice site	probably benign
R3752:Vps35	UTSW	8	85274831	missense	probably benign	0.34
R4589:Vps35	UTSW	8	85287702	missense	probably damaging	1.00
R4745:Vps35	UTSW	8	85261262	missense	probably benign
R4790:Vps35	UTSW	8	85278857	splice site	probably null
R4827:Vps35	UTSW	8	85273557	missense	possibly damaging	0.94
R4953:Vps35	UTSW	8	85281846	missense	probably damaging	1.00
R6277:Vps35	UTSW	8	85261228	missense	possibly damaging	0.80
R6291:Vps35	UTSW	8	85299457	start codon destroyed	probably benign	0.07
R6434:Vps35	UTSW	8	85273495	missense	possibly damaging	0.53
R7175:Vps35	UTSW	8	85263560	splice site	probably null
R7206:Vps35	UTSW	8	85287721	missense	probably damaging	1.00
R7309:Vps35	UTSW	8	85274967	missense	probably benign	0.05
R7479:Vps35	UTSW	8	85270805	missense	probably benign	0.17
R7547:Vps35	UTSW	8	85263370	missense	probably damaging	1.00
R7761:Vps35	UTSW	8	85284078	missense	possibly damaging	0.91
R7812:Vps35	UTSW	8	85284189	missense	probably benign	0.01
R8312:Vps35	UTSW	8	85274869	missense	possibly damaging	0.65
R8356:Vps35	UTSW	8	85261305	missense	possibly damaging	0.63
R8403:Vps35	UTSW	8	85274858	missense	probably benign
R8456:Vps35	UTSW	8	85261305	missense	possibly damaging	0.63
X0020:Vps35	UTSW	8	85263421	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCATTAAGCGTGAGGAAAGGTTACA -3'
(R):5'- GCAGTAGTCCTTGAcctctggctataa -3'

Sequencing Primer
(F):5'- GGAAAGGTTACAGTAAGAGATAACTC -3'
(R):5'- actctgccttagccctttttc -3'

Posted On

2013-05-09