Mutagenetix > Incidental Mutation

Incidental Mutation 'R0226:Stxbp5'

33935

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

038471-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0226 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 9866698 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123253 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

probably benign
Transcript: ENSMUST00000038213

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000125200

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000141722

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	G	T	14: 59,142,120	T54K	possibly damaging	Het
2210408I21Rik	A	T	13: 77,303,425	E876V	possibly damaging	Het
Aasdh	A	T	5: 76,902,002	L49Q	probably damaging	Het
Abca8b	T	C	11: 109,957,018		probably null	Het
Ablim1	A	T	19: 57,043,870	L556Q	probably damaging	Het
Afdn	A	G	17: 13,899,146	T1700A	probably benign	Het
Agl	G	A	3: 116,752,071	R1359C	probably damaging	Het
Agpat3	T	A	10: 78,278,029	H275L	possibly damaging	Het
Ahcyl1	A	T	3: 107,670,270	C180*	probably null	Het
Aim2	A	G	1: 173,462,333		probably benign	Het
Angpt1	T	C	15: 42,468,235	N320S	probably benign	Het
Ankrd52	T	A	10: 128,389,858		probably null	Het
Ap1g1	C	T	8: 109,855,062	S654L	probably benign	Het
Bpifa1	T	A	2: 154,146,057	S173R	probably benign	Het
Brd8	T	C	18: 34,603,894		probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
C1qtnf2	A	G	11: 43,490,843	T161A	probably benign	Het
Car6	T	C	4: 150,187,508	Y228C	probably damaging	Het
Ccdc149	A	G	5: 52,400,217	L273P	probably damaging	Het
Cit	G	A	5: 115,984,840	R1405Q	probably damaging	Het
Cox17	T	C	16: 38,349,276	L48P	probably damaging	Het
Cttn	A	G	7: 144,441,852		probably benign	Het
Cyp4f18	T	C	8: 71,989,775		probably benign	Het
Dtnbp1	A	G	13: 44,923,193	L175P	probably damaging	Het
Efl1	T	C	7: 82,693,011		probably benign	Het
Fbn1	C	T	2: 125,320,910	R2152Q	possibly damaging	Het
Fignl1	A	T	11: 11,801,061	S665T	probably benign	Het
Gm884	A	T	11: 103,603,241	F663L	probably benign	Het
Gm9843	A	T	16: 76,403,561		noncoding transcript	Het
Gpr155	C	T	2: 73,367,592	V395I	probably benign	Het
Greb1l	T	C	18: 10,522,076		probably benign	Het
Hdgfl1	A	T	13: 26,769,996	H31Q	probably benign	Het
Heatr1	T	C	13: 12,410,562	S628P	probably damaging	Het
Hivep2	A	G	10: 14,129,712	T685A	probably benign	Het
Hmgcl	T	G	4: 135,958,728	V168G	probably damaging	Het
Itch	T	C	2: 155,199,394	I454T	probably benign	Het
Itih2	T	C	2: 10,115,299	D309G	possibly damaging	Het
Kcmf1	T	C	6: 72,842,952	I304V	probably benign	Het
Kcnh1	G	A	1: 192,276,804	W222*	probably null	Het
Kcnh1	G	T	1: 192,276,805	W222C	probably damaging	Het
Kif24	T	A	4: 41,414,939	K287*	probably null	Het
Lrig3	A	G	10: 125,972,117		probably benign	Het
Lrp2	A	T	2: 69,537,563	C202S	probably null	Het
Lrrn2	A	G	1: 132,937,820	N208D	probably damaging	Het
Mcm5	C	T	8: 75,126,252	T664I	possibly damaging	Het
Mfsd10	A	G	5: 34,634,446	L365S	probably benign	Het
Mfsd6	A	G	1: 52,658,690		probably benign	Het
Mgat4e	A	G	1: 134,541,103	V401A	probably benign	Het
Mllt3	C	A	4: 87,840,732	V360L	probably benign	Het
Mrm1	G	A	11: 84,819,170	A68V	possibly damaging	Het
Myo19	A	G	11: 84,897,732		probably benign	Het
Myo3b	A	G	2: 70,217,166	T311A	probably benign	Het
Myo5b	T	C	18: 74,742,180	F1552L	probably benign	Het
Myo7b	C	T	18: 31,972,896	V1353I	probably benign	Het
Myo9b	T	C	8: 71,353,832	S1512P	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Osbpl3	A	G	6: 50,353,008	W63R	probably damaging	Het
Pcdh17	T	C	14: 84,448,201	S703P	probably damaging	Het
Pclo	T	C	5: 14,765,223	I1231T	probably damaging	Het
Pex16	A	C	2: 92,375,687		probably benign	Het
Pfkl	T	C	10: 77,992,534	N399S	probably benign	Het
Pkhd1l1	G	A	15: 44,526,784	R1432K	possibly damaging	Het
Prdm1	T	A	10: 44,456,696	T106S	probably benign	Het
Prrc1	A	G	18: 57,363,291	M105V	probably benign	Het
Psg26	A	G	7: 18,483,958	C12R	possibly damaging	Het
Rnf43	A	T	11: 87,731,437	S455C	probably damaging	Het
Ryr2	T	C	13: 11,772,556	K977R	probably damaging	Het
Sart1	C	T	19: 5,381,122		probably benign	Het
Sec14l5	A	G	16: 5,180,303	S509G	probably benign	Het
Sin3b	A	T	8: 72,744,508	E361V	probably benign	Het
Slc35e3	C	T	10: 117,740,890	E179K	possibly damaging	Het
Sntb2	T	C	8: 107,001,583	S388P	probably damaging	Het
Srms	A	G	2: 181,212,382	S131P	probably benign	Het
Taar2	T	C	10: 23,941,063	V167A	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Thsd7a	A	G	6: 12,321,900	Y1516H	possibly damaging	Het
Tlk1	T	A	2: 70,714,169		probably benign	Het
Tmem173	A	T	18: 35,739,088	F120L	probably benign	Het
Tnfaip3	T	C	10: 19,002,747	K771R	probably damaging	Het
Treml1	C	T	17: 48,360,458	L124F	probably damaging	Het
Ttn	G	T	2: 76,780,797	Q9137K	possibly damaging	Het
Unkl	T	A	17: 25,230,711	I469N	probably damaging	Het
Vmn1r173	G	T	7: 23,703,083	V248L	possibly damaging	Het
Vps35	T	C	8: 85,273,575	Q474R	probably damaging	Het
Wdr17	T	A	8: 54,663,008	T580S	probably benign	Het
Xpnpep1	T	C	19: 53,010,152	K222E	probably benign	Het
Ylpm1	A	G	12: 85,049,737	T1446A	probably benign	Het
Zfp277	A	G	12: 40,364,162	L228S	possibly damaging	Het
Zfp941	T	A	7: 140,813,275	K57M	probably damaging	Het
Zmpste24	A	T	4: 121,081,209	S244R	probably benign	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
R9172:Stxbp5	UTSW	10	9769408	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9843357	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9812010	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9899194	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGTGTGACTATTTGCAGTGGCACC -3'
(R):5'- ATGGCATTTCCCGTAGAGACTGGC -3'

Sequencing Primer
(F):5'- ATGACTGCATCTGACTCTCAAG -3'
(R):5'- ACTGGCACGTAGAGACTATTAG -3'

Posted On

2013-05-09