Incidental Mutation 'R0226:Hivep2'
ID33936
Institutional Source Beutler Lab
Gene Symbol Hivep2
Ensembl Gene ENSMUSG00000015501
Gene Namehuman immunodeficiency virus type I enhancer binding protein 2
SynonymsShn-2, MIBP1, Schnurri-2, Gm20114
MMRRC Submission 038471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R0226 (G1)
Quality Score202
Status Validated
Chromosome10
Chromosomal Location13966075-14151374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14129712 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 685 (T685A)
Ref Sequence ENSEMBL: ENSMUSP00000140150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015645] [ENSMUST00000186989] [ENSMUST00000187083] [ENSMUST00000191138]
Predicted Effect probably benign
Transcript: ENSMUST00000015645
AA Change: T685A

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000015645
Gene: ENSMUSG00000015501
AA Change: T685A

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186989
SMART Domains Protein: ENSMUSP00000140180
Gene: ENSMUSG00000015501

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 7.9e-6 SMART
ZnF_C2H2 217 239 3.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187083
AA Change: T685A

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140290
Gene: ENSMUSG00000015501
AA Change: T685A

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191138
AA Change: T685A

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140150
Gene: ENSMUSG00000015501
AA Change: T685A

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of closely related, large, zinc finger-containing transcription factors. The encoded protein regulates transcription by binding to regulatory regions of various cellular and viral genes that maybe involved in growth, development and metastasis. The protein contains the ZAS domain comprised of two widely separated regions of zinc finger motifs, a stretch of highly acidic amino acids and a serine/threonine-rich sequence. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display abnormal thymus anatomy, severely defective positive selection of CD4+ and CD8+ cells, and enhanced T-helper 2 cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Hivep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Hivep2 APN 10 14142244 missense probably damaging 1.00
IGL00963:Hivep2 APN 10 14129347 missense probably damaging 1.00
IGL01066:Hivep2 APN 10 14149024 missense possibly damaging 0.92
IGL01395:Hivep2 APN 10 14132800 critical splice donor site probably null
IGL01474:Hivep2 APN 10 14143662 missense probably damaging 1.00
IGL01481:Hivep2 APN 10 14149237 missense probably benign
IGL01597:Hivep2 APN 10 14149374 nonsense probably null
IGL01719:Hivep2 APN 10 14130523 missense probably damaging 1.00
IGL01952:Hivep2 APN 10 14142331 missense possibly damaging 0.54
IGL02170:Hivep2 APN 10 14127804 missense possibly damaging 0.46
IGL02315:Hivep2 APN 10 14131239 missense probably benign 0.01
IGL02517:Hivep2 APN 10 14131182 missense probably benign 0.01
IGL02535:Hivep2 APN 10 14139497 missense probably damaging 1.00
IGL02539:Hivep2 APN 10 14131878 missense probably damaging 0.97
IGL02637:Hivep2 APN 10 14130708 missense possibly damaging 0.89
IGL02715:Hivep2 APN 10 14131387 missense probably benign 0.03
IGL02948:Hivep2 APN 10 14129013 missense probably benign 0.44
IGL03113:Hivep2 APN 10 14130651 missense probably damaging 1.00
IGL03161:Hivep2 APN 10 14143356 missense probably damaging 1.00
IGL03173:Hivep2 APN 10 14127982 missense possibly damaging 0.75
IGL03310:Hivep2 APN 10 14143667 missense probably damaging 1.00
R0005:Hivep2 UTSW 10 14128749 missense probably damaging 0.99
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0136:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R0143:Hivep2 UTSW 10 14129355 missense probably damaging 1.00
R0172:Hivep2 UTSW 10 14139474 missense probably damaging 1.00
R0348:Hivep2 UTSW 10 14129958 missense possibly damaging 0.76
R0352:Hivep2 UTSW 10 14143295 missense possibly damaging 0.74
R0657:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R1710:Hivep2 UTSW 10 14129505 nonsense probably null
R1959:Hivep2 UTSW 10 14132709 missense probably benign 0.02
R2017:Hivep2 UTSW 10 14130757 missense probably damaging 0.96
R2085:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2085:Hivep2 UTSW 10 14139529 nonsense probably null
R2163:Hivep2 UTSW 10 14128226 nonsense probably null
R2206:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2207:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2228:Hivep2 UTSW 10 14128363 missense probably damaging 1.00
R2241:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2242:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2243:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2246:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2247:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2273:Hivep2 UTSW 10 14132443 missense probably benign 0.02
R2357:Hivep2 UTSW 10 14143299 missense probably benign 0.01
R2517:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2519:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2858:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2859:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2916:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2921:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3051:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3177:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3277:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3620:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3621:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3701:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3802:Hivep2 UTSW 10 14148961 missense possibly damaging 0.94
R3810:Hivep2 UTSW 10 14130357 missense probably benign
R3811:Hivep2 UTSW 10 14130357 missense probably benign
R3817:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3818:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3819:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3836:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3837:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3838:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3839:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3897:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3900:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3932:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3954:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3957:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4001:Hivep2 UTSW 10 14127732 missense probably damaging 1.00
R4134:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4180:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4248:Hivep2 UTSW 10 14131555 missense probably damaging 1.00
R4416:Hivep2 UTSW 10 14129170 missense probably benign
R4436:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4437:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4474:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4475:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4476:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4636:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4637:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4791:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4792:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4825:Hivep2 UTSW 10 14131319 missense possibly damaging 0.81
R4955:Hivep2 UTSW 10 14130958 missense probably benign 0.44
R5094:Hivep2 UTSW 10 14132149 missense probably benign
R5129:Hivep2 UTSW 10 14130864 missense probably damaging 1.00
R5163:Hivep2 UTSW 10 14139425 missense probably damaging 1.00
R5255:Hivep2 UTSW 10 14131267 unclassified probably null
R5330:Hivep2 UTSW 10 14131420 missense probably damaging 1.00
R5341:Hivep2 UTSW 10 14132592 missense possibly damaging 0.94
R5453:Hivep2 UTSW 10 14128228 missense possibly damaging 0.78
R5513:Hivep2 UTSW 10 14132673 nonsense probably null
R5535:Hivep2 UTSW 10 14131022 missense probably benign 0.00
R5613:Hivep2 UTSW 10 14139495 missense probably damaging 1.00
R5804:Hivep2 UTSW 10 14133775 missense probably benign 0.01
R6074:Hivep2 UTSW 10 14131741 missense probably benign 0.18
R6163:Hivep2 UTSW 10 14129992 missense probably damaging 0.98
R6250:Hivep2 UTSW 10 14131759 missense probably benign 0.01
R6696:Hivep2 UTSW 10 14133759 missense probably benign 0.06
R6754:Hivep2 UTSW 10 14129638 missense probably benign 0.06
R6756:Hivep2 UTSW 10 14132559 missense probably damaging 1.00
R6799:Hivep2 UTSW 10 14129013 missense probably benign 0.28
R6862:Hivep2 UTSW 10 14130583 missense probably damaging 1.00
R6932:Hivep2 UTSW 10 14128501 missense probably damaging 1.00
R6943:Hivep2 UTSW 10 14128314 missense probably damaging 1.00
R7027:Hivep2 UTSW 10 14149577 missense probably damaging 0.99
R7027:Hivep2 UTSW 10 14149578 missense probably damaging 1.00
R7198:Hivep2 UTSW 10 14129966 missense probably benign
R7248:Hivep2 UTSW 10 14131165 missense possibly damaging 0.86
R7256:Hivep2 UTSW 10 14129101 missense probably benign 0.29
R7426:Hivep2 UTSW 10 14131317 missense possibly damaging 0.93
R7427:Hivep2 UTSW 10 14133741 missense possibly damaging 0.94
R7638:Hivep2 UTSW 10 14143851 missense possibly damaging 0.81
R7731:Hivep2 UTSW 10 14149714 missense probably benign
R7740:Hivep2 UTSW 10 14127670 missense probably damaging 1.00
R7797:Hivep2 UTSW 10 14130103 missense probably benign
Z1177:Hivep2 UTSW 10 14131786 missense probably damaging 1.00
Z1177:Hivep2 UTSW 10 14143307 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCAGTCCATCCCTGAAGGAAAAG -3'
(R):5'- TGGATCAGCAGCCAAGGGCAAATC -3'

Sequencing Primer
(F):5'- GAAATTACTTCCCGGAGACAGG -3'
(R):5'- ATGGACTTCTAGATGGCAGC -3'
Posted On2013-05-09