Mutagenetix > Incidental Mutations

Incidental Mutation 'R0226:Pfkl'

33941

Institutional Source

Beutler Lab

Gene Symbol

Pfkl

Ensembl Gene

ENSMUSG00000020277

Gene Name

phosphofructokinase, liver, B-type

Synonyms

MMRRC Submission

038471-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0226 (G1)

Quality Score

146

Status

Validated

Chromosome

Chromosomal Location

77986947-78010083 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77992534 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 399 (N399S)

Ref Sequence

ENSEMBL: ENSMUSP00000020522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020522]

Predicted Effect

probably benign
Transcript: ENSMUST00000020522
AA Change: N399S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277
AA Change: N399S

Domain	Start	End	E-Value	Type
Pfam:PFK	17	324	4.7e-109	PFAM
Pfam:PFK	401	686	1.9e-98	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148818

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149271

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218921

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220064

Meta Mutation Damage Score

0.0584

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	G	T	14: 59,142,120	T54K	possibly damaging	Het
2210408I21Rik	A	T	13: 77,303,425	E876V	possibly damaging	Het
Aasdh	A	T	5: 76,902,002	L49Q	probably damaging	Het
Abca8b	T	C	11: 109,957,018		probably null	Het
Ablim1	A	T	19: 57,043,870	L556Q	probably damaging	Het
Afdn	A	G	17: 13,899,146	T1700A	probably benign	Het
Agl	G	A	3: 116,752,071	R1359C	probably damaging	Het
Agpat3	T	A	10: 78,278,029	H275L	possibly damaging	Het
Ahcyl1	A	T	3: 107,670,270	C180*	probably null	Het
Aim2	A	G	1: 173,462,333		probably benign	Het
Angpt1	T	C	15: 42,468,235	N320S	probably benign	Het
Ankrd52	T	A	10: 128,389,858		probably null	Het
Ap1g1	C	T	8: 109,855,062	S654L	probably benign	Het
Bpifa1	T	A	2: 154,146,057	S173R	probably benign	Het
Brd8	T	C	18: 34,603,894		probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
C1qtnf2	A	G	11: 43,490,843	T161A	probably benign	Het
Car6	T	C	4: 150,187,508	Y228C	probably damaging	Het
Ccdc149	A	G	5: 52,400,217	L273P	probably damaging	Het
Cit	G	A	5: 115,984,840	R1405Q	probably damaging	Het
Cox17	T	C	16: 38,349,276	L48P	probably damaging	Het
Cttn	A	G	7: 144,441,852		probably benign	Het
Cyp4f18	T	C	8: 71,989,775		probably benign	Het
Dtnbp1	A	G	13: 44,923,193	L175P	probably damaging	Het
Efl1	T	C	7: 82,693,011		probably benign	Het
Fbn1	C	T	2: 125,320,910	R2152Q	possibly damaging	Het
Fignl1	A	T	11: 11,801,061	S665T	probably benign	Het
Gm884	A	T	11: 103,603,241	F663L	probably benign	Het
Gm9843	A	T	16: 76,403,561		noncoding transcript	Het
Gpr155	C	T	2: 73,367,592	V395I	probably benign	Het
Greb1l	T	C	18: 10,522,076		probably benign	Het
Hdgfl1	A	T	13: 26,769,996	H31Q	probably benign	Het
Heatr1	T	C	13: 12,410,562	S628P	probably damaging	Het
Hivep2	A	G	10: 14,129,712	T685A	probably benign	Het
Hmgcl	T	G	4: 135,958,728	V168G	probably damaging	Het
Itch	T	C	2: 155,199,394	I454T	probably benign	Het
Itih2	T	C	2: 10,115,299	D309G	possibly damaging	Het
Kcmf1	T	C	6: 72,842,952	I304V	probably benign	Het
Kcnh1	G	A	1: 192,276,804	W222*	probably null	Het
Kcnh1	G	T	1: 192,276,805	W222C	probably damaging	Het
Kif24	T	A	4: 41,414,939	K287*	probably null	Het
Lrig3	A	G	10: 125,972,117		probably benign	Het
Lrp2	A	T	2: 69,537,563	C202S	probably null	Het
Lrrn2	A	G	1: 132,937,820	N208D	probably damaging	Het
Mcm5	C	T	8: 75,126,252	T664I	possibly damaging	Het
Mfsd10	A	G	5: 34,634,446	L365S	probably benign	Het
Mfsd6	A	G	1: 52,658,690		probably benign	Het
Mgat4e	A	G	1: 134,541,103	V401A	probably benign	Het
Mllt3	C	A	4: 87,840,732	V360L	probably benign	Het
Mrm1	G	A	11: 84,819,170	A68V	possibly damaging	Het
Myo19	A	G	11: 84,897,732		probably benign	Het
Myo3b	A	G	2: 70,217,166	T311A	probably benign	Het
Myo5b	T	C	18: 74,742,180	F1552L	probably benign	Het
Myo7b	C	T	18: 31,972,896	V1353I	probably benign	Het
Myo9b	T	C	8: 71,353,832	S1512P	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Osbpl3	A	G	6: 50,353,008	W63R	probably damaging	Het
Pcdh17	T	C	14: 84,448,201	S703P	probably damaging	Het
Pclo	T	C	5: 14,765,223	I1231T	probably damaging	Het
Pex16	A	C	2: 92,375,687		probably benign	Het
Pkhd1l1	G	A	15: 44,526,784	R1432K	possibly damaging	Het
Prdm1	T	A	10: 44,456,696	T106S	probably benign	Het
Prrc1	A	G	18: 57,363,291	M105V	probably benign	Het
Psg26	A	G	7: 18,483,958	C12R	possibly damaging	Het
Rnf43	A	T	11: 87,731,437	S455C	probably damaging	Het
Ryr2	T	C	13: 11,772,556	K977R	probably damaging	Het
Sart1	C	T	19: 5,381,122		probably benign	Het
Sec14l5	A	G	16: 5,180,303	S509G	probably benign	Het
Sin3b	A	T	8: 72,744,508	E361V	probably benign	Het
Slc35e3	C	T	10: 117,740,890	E179K	possibly damaging	Het
Sntb2	T	C	8: 107,001,583	S388P	probably damaging	Het
Srms	A	G	2: 181,212,382	S131P	probably benign	Het
Stxbp5	T	C	10: 9,866,698		probably benign	Het
Taar2	T	C	10: 23,941,063	V167A	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Thsd7a	A	G	6: 12,321,900	Y1516H	possibly damaging	Het
Tlk1	T	A	2: 70,714,169		probably benign	Het
Tmem173	A	T	18: 35,739,088	F120L	probably benign	Het
Tnfaip3	T	C	10: 19,002,747	K771R	probably damaging	Het
Treml1	C	T	17: 48,360,458	L124F	probably damaging	Het
Ttn	G	T	2: 76,780,797	Q9137K	possibly damaging	Het
Unkl	T	A	17: 25,230,711	I469N	probably damaging	Het
Vmn1r173	G	T	7: 23,703,083	V248L	possibly damaging	Het
Vps35	T	C	8: 85,273,575	Q474R	probably damaging	Het
Wdr17	T	A	8: 54,663,008	T580S	probably benign	Het
Xpnpep1	T	C	19: 53,010,152	K222E	probably benign	Het
Ylpm1	A	G	12: 85,049,737	T1446A	probably benign	Het
Zfp277	A	G	12: 40,364,162	L228S	possibly damaging	Het
Zfp941	T	A	7: 140,813,275	K57M	probably damaging	Het
Zmpste24	A	T	4: 121,081,209	S244R	probably benign	Het

Other mutations in Pfkl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Pfkl	APN	10	77991395	missense	probably benign
IGL01759:Pfkl	APN	10	78000731	missense	probably damaging	1.00
IGL02697:Pfkl	APN	10	77999918	missense	probably benign	0.09
IGL02870:Pfkl	APN	10	78000839	nonsense	probably null
IGL02942:Pfkl	APN	10	78000133	critical splice donor site	probably null
IGL02972:Pfkl	APN	10	77988274	missense	probably benign	0.00
IGL03342:Pfkl	APN	10	78005475	missense	possibly damaging	0.95
ANU23:Pfkl	UTSW	10	77991395	missense	probably benign
R0743:Pfkl	UTSW	10	77995243	critical splice donor site	probably null
R0899:Pfkl	UTSW	10	78005439	critical splice donor site	probably null
R0926:Pfkl	UTSW	10	78000689	missense	probably damaging	1.00
R1264:Pfkl	UTSW	10	77993416	missense	possibly damaging	0.46
R1782:Pfkl	UTSW	10	77988720	missense	probably benign	0.00
R1918:Pfkl	UTSW	10	78001426	missense	probably damaging	1.00
R3743:Pfkl	UTSW	10	77996345	missense	probably damaging	1.00
R4559:Pfkl	UTSW	10	77988883	missense	probably benign	0.00
R4804:Pfkl	UTSW	10	77991394	missense	probably benign
R4823:Pfkl	UTSW	10	77997594	missense	probably damaging	1.00
R4906:Pfkl	UTSW	10	77988310	missense	probably damaging	1.00
R5082:Pfkl	UTSW	10	77996408	missense	probably damaging	1.00
R5216:Pfkl	UTSW	10	78009670	missense	probably damaging	0.99
R5380:Pfkl	UTSW	10	77997589	missense	possibly damaging	0.86
R5816:Pfkl	UTSW	10	78002022	missense	possibly damaging	0.75
R5840:Pfkl	UTSW	10	77988724	missense	probably benign
R5888:Pfkl	UTSW	10	77991370	missense	possibly damaging	0.68
R6143:Pfkl	UTSW	10	77989613	missense	probably damaging	0.96
R6152:Pfkl	UTSW	10	77990151	missense	probably benign	0.00
R6251:Pfkl	UTSW	10	77989565	critical splice donor site	probably null
R6262:Pfkl	UTSW	10	77988673	critical splice donor site	probably null
R6382:Pfkl	UTSW	10	77999837	missense	probably damaging	0.98
R6407:Pfkl	UTSW	10	77988673	critical splice donor site	probably null
R6547:Pfkl	UTSW	10	77995354	missense	probably benign
R6704:Pfkl	UTSW	10	77996366	missense	probably damaging	1.00
R6996:Pfkl	UTSW	10	77997589	missense	probably damaging	1.00
R7116:Pfkl	UTSW	10	78001415	missense	probably benign
R7154:Pfkl	UTSW	10	78001455	missense	probably benign	0.41
R7183:Pfkl	UTSW	10	78002082	nonsense	probably null
R7248:Pfkl	UTSW	10	77989589	missense	probably damaging	1.00
R7252:Pfkl	UTSW	10	77993429	missense	probably damaging	1.00
R7278:Pfkl	UTSW	10	77992023	missense	probably damaging	0.99
R7974:Pfkl	UTSW	10	77994162	missense	probably damaging	1.00
R8686:Pfkl	UTSW	10	77997522	critical splice donor site	probably null
R8900:Pfkl	UTSW	10	78000781	missense	probably damaging	1.00
X0026:Pfkl	UTSW	10	77989643	missense	probably damaging	1.00
Z1176:Pfkl	UTSW	10	78000136	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCAAAGGTGAGTGACTGAGCCC -3'
(R):5'- TGTCCACTATCATGCCAGGAGACC -3'

Sequencing Primer
(F):5'- AGTGACTGAGCCCACAGC -3'
(R):5'- CCTAGCGATGTAGGCAGGAC -3'

Posted On

2013-05-09