Incidental Mutation 'R0226:Agpat3'
ID 33942
Institutional Source Beutler Lab
Gene Symbol Agpat3
Ensembl Gene ENSMUSG00000001211
Gene Name 1-acylglycerol-3-phosphate O-acyltransferase 3
Synonyms D10Jhu12e, LPAAT3
MMRRC Submission 038471-MU
Accession Numbers

NCBI RefSeq: NM_053014.3; MGI: 1336186

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R0226 (G1)
Quality Score 167
Status Validated
Chromosome 10
Chromosomal Location 78269178-78352489 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78278029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 275 (H275L)
Ref Sequence ENSEMBL: ENSMUSP00000132954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001240] [ENSMUST00000105387] [ENSMUST00000105388] [ENSMUST00000105389] [ENSMUST00000105390] [ENSMUST00000166360]
AlphaFold Q9D517
Predicted Effect possibly damaging
Transcript: ENSMUST00000001240
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001240
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105387
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101026
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105388
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101027
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105389
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101028
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105390
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101029
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146296
Predicted Effect possibly damaging
Transcript: ENSMUST00000166360
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132954
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
Pfam:Acyltransf_C 241 314 2.1e-29 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Meta Mutation Damage Score 0.3638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an acyltransferase that converts lysophosphatidic acid into phosphatidic acid, which is the second step in the de novo phospholipid biosynthetic pathway. The encoded protein may be an integral membrane protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with oligozoospermia, teratozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(2) Gene trapped(12)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Agpat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Agpat3 APN 10 78273682 utr 3 prime probably benign
IGL02621:Agpat3 APN 10 78285066 missense probably damaging 1.00
IGL02725:Agpat3 APN 10 78278055 missense probably benign 0.02
P0008:Agpat3 UTSW 10 78287876 missense probably damaging 1.00
PIT4445001:Agpat3 UTSW 10 78274093 missense possibly damaging 0.94
R0041:Agpat3 UTSW 10 78288047 unclassified probably benign
R0126:Agpat3 UTSW 10 78278056 missense probably null 0.59
R1520:Agpat3 UTSW 10 78288023 start codon destroyed probably null 1.00
R2118:Agpat3 UTSW 10 78278084 missense probably damaging 1.00
R5493:Agpat3 UTSW 10 78284235 missense possibly damaging 0.89
R5599:Agpat3 UTSW 10 78274269 missense probably benign 0.39
R6280:Agpat3 UTSW 10 78285038 missense probably damaging 1.00
R7528:Agpat3 UTSW 10 78287912 missense probably damaging 1.00
R7895:Agpat3 UTSW 10 78283200 missense probably benign 0.34
R8351:Agpat3 UTSW 10 78274252 missense probably damaging 1.00
R8425:Agpat3 UTSW 10 78282377 missense possibly damaging 0.89
R8949:Agpat3 UTSW 10 78283155 missense probably benign 0.00
R9136:Agpat3 UTSW 10 78285059 missense probably damaging 1.00
X0003:Agpat3 UTSW 10 78274173 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACTCTAAGGCAGGTGAGTACCAC -3'
(R):5'- TCACGATCAAGGTCAAATGCCACAG -3'

Sequencing Primer
(F):5'- CAGGTGAGTACCACCAGTCTTTG -3'
(R):5'- TGACCATGCCTAGAAGGTTC -3'
Posted On 2013-05-09