Incidental Mutation 'R0226:Agpat3'
ID 33942
Institutional Source Beutler Lab
Gene Symbol Agpat3
Ensembl Gene ENSMUSG00000001211
Gene Name 1-acylglycerol-3-phosphate O-acyltransferase 3
Synonyms D10Jhu12e, LPAAT3
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R0226 (G1)
Quality Score 167
Status Validated
Chromosome 10
Chromosomal Location 78105012-78188323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78113863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 275 (H275L)
Ref Sequence ENSEMBL: ENSMUSP00000132954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001240] [ENSMUST00000105387] [ENSMUST00000105388] [ENSMUST00000105389] [ENSMUST00000105390] [ENSMUST00000166360]
AlphaFold Q9D517
Predicted Effect possibly damaging
Transcript: ENSMUST00000001240
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001240
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105387
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101026
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105388
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101027
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105389
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101028
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105390
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101029
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146296
Predicted Effect possibly damaging
Transcript: ENSMUST00000166360
AA Change: H275L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132954
Gene: ENSMUSG00000001211
AA Change: H275L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
Pfam:Acyltransf_C 241 314 2.1e-29 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Meta Mutation Damage Score 0.3638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an acyltransferase that converts lysophosphatidic acid into phosphatidic acid, which is the second step in the de novo phospholipid biosynthetic pathway. The encoded protein may be an integral membrane protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with oligozoospermia, teratozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(2) Gene trapped(12)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Aasdh A T 5: 77,049,849 (GRCm39) L49Q probably damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Ablim1 A T 19: 57,032,302 (GRCm39) L556Q probably damaging Het
Afdn A G 17: 14,119,408 (GRCm39) T1700A probably benign Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Aim2 A G 1: 173,289,899 (GRCm39) probably benign Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fbn1 C T 2: 125,162,830 (GRCm39) R2152Q possibly damaging Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Rnf43 A T 11: 87,622,263 (GRCm39) S455C probably damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Treml1 C T 17: 48,667,486 (GRCm39) L124F probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp277 A G 12: 40,414,161 (GRCm39) L228S possibly damaging Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Agpat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Agpat3 APN 10 78,109,516 (GRCm39) utr 3 prime probably benign
IGL02621:Agpat3 APN 10 78,120,900 (GRCm39) missense probably damaging 1.00
IGL02725:Agpat3 APN 10 78,113,889 (GRCm39) missense probably benign 0.02
P0008:Agpat3 UTSW 10 78,123,710 (GRCm39) missense probably damaging 1.00
PIT4445001:Agpat3 UTSW 10 78,109,927 (GRCm39) missense possibly damaging 0.94
R0041:Agpat3 UTSW 10 78,123,881 (GRCm39) unclassified probably benign
R0126:Agpat3 UTSW 10 78,113,890 (GRCm39) missense probably null 0.59
R1520:Agpat3 UTSW 10 78,123,857 (GRCm39) start codon destroyed probably null 1.00
R2118:Agpat3 UTSW 10 78,113,918 (GRCm39) missense probably damaging 1.00
R5493:Agpat3 UTSW 10 78,120,069 (GRCm39) missense possibly damaging 0.89
R5599:Agpat3 UTSW 10 78,110,103 (GRCm39) missense probably benign 0.39
R6280:Agpat3 UTSW 10 78,120,872 (GRCm39) missense probably damaging 1.00
R7528:Agpat3 UTSW 10 78,123,746 (GRCm39) missense probably damaging 1.00
R7895:Agpat3 UTSW 10 78,119,034 (GRCm39) missense probably benign 0.34
R8351:Agpat3 UTSW 10 78,110,086 (GRCm39) missense probably damaging 1.00
R8425:Agpat3 UTSW 10 78,118,211 (GRCm39) missense possibly damaging 0.89
R8949:Agpat3 UTSW 10 78,118,989 (GRCm39) missense probably benign 0.00
R9136:Agpat3 UTSW 10 78,120,893 (GRCm39) missense probably damaging 1.00
X0003:Agpat3 UTSW 10 78,110,007 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACTCTAAGGCAGGTGAGTACCAC -3'
(R):5'- TCACGATCAAGGTCAAATGCCACAG -3'

Sequencing Primer
(F):5'- CAGGTGAGTACCACCAGTCTTTG -3'
(R):5'- TGACCATGCCTAGAAGGTTC -3'
Posted On 2013-05-09