Incidental Mutation 'R0226:Rnf43'
ID 33949
Institutional Source Beutler Lab
Gene Symbol Rnf43
Ensembl Gene ENSMUSG00000034177
Gene Name ring finger protein 43
Synonyms 4732452J19Rik
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R0226 (G1)
Quality Score 100
Status Validated
Chromosome 11
Chromosomal Location 87553913-87626365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87622263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 455 (S455C)
Ref Sequence ENSEMBL: ENSMUSP00000130685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040089] [ENSMUST00000092800] [ENSMUST00000121782] [ENSMUST00000165679]
AlphaFold Q5NCP0
Predicted Effect probably damaging
Transcript: ENSMUST00000040089
AA Change: S328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044241
Gene: ENSMUSG00000034177
AA Change: S328C

DomainStartEndE-ValueType
PDB:4KNG|F 1 71 7e-32 PDB
transmembrane domain 72 91 N/A INTRINSIC
RING 145 185 6.43e-8 SMART
low complexity region 337 351 N/A INTRINSIC
low complexity region 366 376 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
low complexity region 646 654 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092800
AA Change: S455C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090476
Gene: ENSMUSG00000034177
AA Change: S455C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121782
AA Change: S414C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112748
Gene: ENSMUSG00000034177
AA Change: S414C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 157 6e-54 PDB
transmembrane domain 158 177 N/A INTRINSIC
RING 231 271 6.43e-8 SMART
low complexity region 423 437 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 577 602 N/A INTRINSIC
low complexity region 732 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150866
Predicted Effect probably damaging
Transcript: ENSMUST00000165679
AA Change: S455C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130685
Gene: ENSMUSG00000034177
AA Change: S455C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162740
Meta Mutation Damage Score 0.1022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RING-type E3 ubiquitin ligase and is predicted to contain a transmembrane domain, a protease-associated domain, an ectodomain, and a cytoplasmic RING domain. This protein is thought to negatively regulate Wnt signaling, and expression of this gene results in an increase in ubiquitination of frizzled receptors, an alteration in their subcellular distribution, resulting in reduced surface levels of these receptors. Mutations in this gene have been reported in multiple tumor cells, including colorectal and endometrial cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Aasdh A T 5: 77,049,849 (GRCm39) L49Q probably damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Ablim1 A T 19: 57,032,302 (GRCm39) L556Q probably damaging Het
Afdn A G 17: 14,119,408 (GRCm39) T1700A probably benign Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Agpat3 T A 10: 78,113,863 (GRCm39) H275L possibly damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Aim2 A G 1: 173,289,899 (GRCm39) probably benign Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fbn1 C T 2: 125,162,830 (GRCm39) R2152Q possibly damaging Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Treml1 C T 17: 48,667,486 (GRCm39) L124F probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp277 A G 12: 40,414,161 (GRCm39) L228S possibly damaging Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Rnf43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Rnf43 APN 11 87,622,718 (GRCm39) missense probably benign 0.15
IGL01520:Rnf43 APN 11 87,555,542 (GRCm39) missense probably damaging 1.00
IGL01541:Rnf43 APN 11 87,621,046 (GRCm39) missense probably null 1.00
IGL01784:Rnf43 APN 11 87,622,632 (GRCm39) missense possibly damaging 0.56
IGL02037:Rnf43 APN 11 87,622,479 (GRCm39) missense probably benign 0.00
IGL02725:Rnf43 APN 11 87,622,411 (GRCm39) missense probably damaging 1.00
IGL03062:Rnf43 APN 11 87,623,130 (GRCm39) nonsense probably null
R0391:Rnf43 UTSW 11 87,622,108 (GRCm39) missense possibly damaging 0.86
R0834:Rnf43 UTSW 11 87,622,077 (GRCm39) missense probably benign
R1163:Rnf43 UTSW 11 87,620,339 (GRCm39) missense probably damaging 0.98
R1203:Rnf43 UTSW 11 87,618,301 (GRCm39) splice site probably benign
R1314:Rnf43 UTSW 11 87,623,145 (GRCm39) missense probably benign
R1404:Rnf43 UTSW 11 87,625,003 (GRCm39) missense possibly damaging 0.82
R1404:Rnf43 UTSW 11 87,625,003 (GRCm39) missense possibly damaging 0.82
R1469:Rnf43 UTSW 11 87,622,233 (GRCm39) missense probably damaging 1.00
R1469:Rnf43 UTSW 11 87,622,233 (GRCm39) missense probably damaging 1.00
R1511:Rnf43 UTSW 11 87,622,173 (GRCm39) missense probably benign 0.00
R1513:Rnf43 UTSW 11 87,620,257 (GRCm39) missense probably damaging 1.00
R1614:Rnf43 UTSW 11 87,622,485 (GRCm39) nonsense probably null
R1615:Rnf43 UTSW 11 87,622,485 (GRCm39) nonsense probably null
R2341:Rnf43 UTSW 11 87,622,851 (GRCm39) missense probably damaging 0.96
R2410:Rnf43 UTSW 11 87,623,085 (GRCm39) missense possibly damaging 0.94
R2847:Rnf43 UTSW 11 87,623,093 (GRCm39) missense probably benign 0.04
R2849:Rnf43 UTSW 11 87,623,093 (GRCm39) missense probably benign 0.04
R5567:Rnf43 UTSW 11 87,618,271 (GRCm39) missense probably damaging 1.00
R5943:Rnf43 UTSW 11 87,622,561 (GRCm39) missense probably damaging 1.00
R6135:Rnf43 UTSW 11 87,622,951 (GRCm39) missense probably damaging 1.00
R6452:Rnf43 UTSW 11 87,623,079 (GRCm39) missense probably damaging 1.00
R6511:Rnf43 UTSW 11 87,622,989 (GRCm39) missense probably benign 0.01
R7426:Rnf43 UTSW 11 87,622,678 (GRCm39) missense probably benign 0.03
R7528:Rnf43 UTSW 11 87,622,954 (GRCm39) missense probably benign 0.00
R8029:Rnf43 UTSW 11 87,622,720 (GRCm39) missense probably benign 0.06
R8167:Rnf43 UTSW 11 87,618,232 (GRCm39) missense probably benign 0.03
R8174:Rnf43 UTSW 11 87,622,057 (GRCm39) missense probably benign 0.39
R8498:Rnf43 UTSW 11 87,618,267 (GRCm39) missense probably damaging 1.00
R8905:Rnf43 UTSW 11 87,621,951 (GRCm39) missense probably damaging 1.00
R9214:Rnf43 UTSW 11 87,622,111 (GRCm39) missense probably benign 0.17
R9562:Rnf43 UTSW 11 87,618,891 (GRCm39) missense probably benign 0.03
X0064:Rnf43 UTSW 11 87,618,168 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTTACCAGGAACCAGGCAGAAGAC -3'
(R):5'- AAGGGGTCAAAGTCACTGCTCAGG -3'

Sequencing Primer
(F):5'- GCCTTCCAGGACTTCAGTCG -3'
(R):5'- AGTTGACCACCGAGTCACT -3'
Posted On 2013-05-09