Incidental Mutation 'R0226:Zfp277'
ID 33951
Institutional Source Beutler Lab
Gene Symbol Zfp277
Ensembl Gene ENSMUSG00000055917
Gene Name zinc finger protein 277
Synonyms NIRF4, 2410017E24Rik
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0226 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 40365045-40495789 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40414161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 228 (L228S)
Ref Sequence ENSEMBL: ENSMUSP00000064226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069637] [ENSMUST00000069692]
AlphaFold E9Q6D6
Predicted Effect probably benign
Transcript: ENSMUST00000069637
AA Change: L102S

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068032
Gene: ENSMUSG00000055917
AA Change: L102S

DomainStartEndE-ValueType
ZnF_C2H2 59 84 4.27e1 SMART
coiled coil region 143 171 N/A INTRINSIC
ZnF_C2H2 174 198 3.85e1 SMART
ZnF_C2H2 225 249 2.24e-3 SMART
low complexity region 280 292 N/A INTRINSIC
ZnF_C2H2 303 326 1.91e1 SMART
ZnF_C2H2 356 382 4.94e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069692
AA Change: L228S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064226
Gene: ENSMUSG00000055917
AA Change: L228S

DomainStartEndE-ValueType
ZnF_C2H2 185 210 4.27e1 SMART
coiled coil region 269 297 N/A INTRINSIC
ZnF_C2H2 300 324 3.85e1 SMART
ZnF_C2H2 351 375 2.24e-3 SMART
low complexity region 406 418 N/A INTRINSIC
ZnF_C2H2 429 452 1.91e1 SMART
ZnF_C2H2 482 508 4.94e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221847
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early cellular preplicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Aasdh A T 5: 77,049,849 (GRCm39) L49Q probably damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Ablim1 A T 19: 57,032,302 (GRCm39) L556Q probably damaging Het
Afdn A G 17: 14,119,408 (GRCm39) T1700A probably benign Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Agpat3 T A 10: 78,113,863 (GRCm39) H275L possibly damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Aim2 A G 1: 173,289,899 (GRCm39) probably benign Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fbn1 C T 2: 125,162,830 (GRCm39) R2152Q possibly damaging Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Rnf43 A T 11: 87,622,263 (GRCm39) S455C probably damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Treml1 C T 17: 48,667,486 (GRCm39) L124F probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Zfp277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Zfp277 APN 12 40,428,825 (GRCm39) missense probably benign 0.24
IGL01477:Zfp277 APN 12 40,370,675 (GRCm39) missense probably benign 0.00
IGL02081:Zfp277 APN 12 40,378,795 (GRCm39) nonsense probably null
IGL02165:Zfp277 APN 12 40,365,802 (GRCm39) missense possibly damaging 0.75
IGL02613:Zfp277 APN 12 40,379,514 (GRCm39) missense probably damaging 1.00
IGL02688:Zfp277 APN 12 40,378,687 (GRCm39) missense possibly damaging 0.95
IGL02825:Zfp277 APN 12 40,367,175 (GRCm39) missense probably benign 0.06
R0194:Zfp277 UTSW 12 40,428,876 (GRCm39) splice site probably benign
R0843:Zfp277 UTSW 12 40,370,599 (GRCm39) critical splice donor site probably null
R1263:Zfp277 UTSW 12 40,414,164 (GRCm39) missense probably damaging 0.99
R1584:Zfp277 UTSW 12 40,428,825 (GRCm39) missense probably benign 0.12
R1609:Zfp277 UTSW 12 40,378,719 (GRCm39) missense probably damaging 0.99
R1644:Zfp277 UTSW 12 40,379,609 (GRCm39) splice site probably null
R1789:Zfp277 UTSW 12 40,414,084 (GRCm39) missense probably benign 0.00
R1882:Zfp277 UTSW 12 40,495,745 (GRCm39) missense probably benign 0.03
R2011:Zfp277 UTSW 12 40,367,217 (GRCm39) nonsense probably null
R4884:Zfp277 UTSW 12 40,413,152 (GRCm39) missense probably damaging 0.97
R4976:Zfp277 UTSW 12 40,378,687 (GRCm39) missense possibly damaging 0.95
R5119:Zfp277 UTSW 12 40,378,687 (GRCm39) missense possibly damaging 0.95
R5532:Zfp277 UTSW 12 40,385,308 (GRCm39) missense probably damaging 1.00
R6340:Zfp277 UTSW 12 40,368,548 (GRCm39) missense possibly damaging 0.57
R7191:Zfp277 UTSW 12 40,379,561 (GRCm39) missense probably damaging 1.00
R7378:Zfp277 UTSW 12 40,365,852 (GRCm39) missense possibly damaging 0.94
R7446:Zfp277 UTSW 12 40,378,729 (GRCm39) missense probably damaging 1.00
R7564:Zfp277 UTSW 12 40,379,594 (GRCm39) missense probably damaging 0.99
R7861:Zfp277 UTSW 12 40,365,880 (GRCm39) missense possibly damaging 0.92
R8428:Zfp277 UTSW 12 40,379,577 (GRCm39) missense probably damaging 1.00
R9673:Zfp277 UTSW 12 40,370,611 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCAGCAATCATGCAATGAGAGCAAGT -3'
(R):5'- CCCCTAATTCCTGCGCTTTAAATGCTTA -3'

Sequencing Primer
(F):5'- CAATGAGAGCAAGTGCAATTTAAGAG -3'
(R):5'- gaaggtagagggtgaaaaatcag -3'
Posted On 2013-05-09