Incidental Mutation 'R0226:Afdn'
ID 33964
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Name afadin, adherens junction formation factor
Synonyms Mllt4, AF6, S-afadin, Afadin, I-afadin, 5033403D15Rik
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0226 (G1)
Quality Score 190
Status Validated
Chromosome 17
Chromosomal Location 13980735-14126059 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14119408 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1700 (T1700A)
Ref Sequence ENSEMBL: ENSMUSP00000128891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
AlphaFold Q9QZQ1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133422
Predicted Effect unknown
Transcript: ENSMUST00000137531
AA Change: T274A
SMART Domains Protein: ENSMUSP00000116711
Gene: ENSMUSG00000068036
AA Change: T274A

DomainStartEndE-ValueType
coiled coil region 70 110 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137708
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137784
AA Change: T1722A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: T1722A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139666
AA Change: T1715A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: T1715A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150848
AA Change: T1700A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: T1700A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170827
AA Change: T1700A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: T1700A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Aasdh A T 5: 77,049,849 (GRCm39) L49Q probably damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Ablim1 A T 19: 57,032,302 (GRCm39) L556Q probably damaging Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Agpat3 T A 10: 78,113,863 (GRCm39) H275L possibly damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Aim2 A G 1: 173,289,899 (GRCm39) probably benign Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fbn1 C T 2: 125,162,830 (GRCm39) R2152Q possibly damaging Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Rnf43 A T 11: 87,622,263 (GRCm39) S455C probably damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Treml1 C T 17: 48,667,486 (GRCm39) L124F probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp277 A G 12: 40,414,161 (GRCm39) L228S possibly damaging Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 14,104,890 (GRCm39) missense probably damaging 1.00
IGL00784:Afdn APN 17 14,069,525 (GRCm39) splice site probably benign
IGL00971:Afdn APN 17 14,072,575 (GRCm39) splice site probably benign
IGL01403:Afdn APN 17 14,124,132 (GRCm39) missense probably damaging 1.00
IGL01944:Afdn APN 17 14,030,743 (GRCm39) missense probably damaging 1.00
IGL02474:Afdn APN 17 14,038,491 (GRCm39) missense probably damaging 1.00
IGL02615:Afdn APN 17 14,046,238 (GRCm39) missense probably benign 0.00
IGL02664:Afdn APN 17 14,072,728 (GRCm39) splice site probably benign
IGL03036:Afdn APN 17 14,108,350 (GRCm39) missense probably benign 0.12
jubilee UTSW 17 14,108,248 (GRCm39) missense probably damaging 1.00
IGL03134:Afdn UTSW 17 14,066,548 (GRCm39) missense probably benign 0.04
R0112:Afdn UTSW 17 14,104,899 (GRCm39) missense probably damaging 1.00
R0305:Afdn UTSW 17 14,108,776 (GRCm39) splice site probably null
R0310:Afdn UTSW 17 14,105,770 (GRCm39) critical splice donor site probably null
R0711:Afdn UTSW 17 14,072,698 (GRCm39) missense probably damaging 1.00
R0828:Afdn UTSW 17 14,124,260 (GRCm39) missense probably damaging 1.00
R1268:Afdn UTSW 17 14,108,248 (GRCm39) missense probably damaging 1.00
R1317:Afdn UTSW 17 14,066,535 (GRCm39) missense probably benign 0.11
R1386:Afdn UTSW 17 14,066,798 (GRCm39) missense probably damaging 1.00
R1438:Afdn UTSW 17 14,075,652 (GRCm39) missense probably damaging 1.00
R1607:Afdn UTSW 17 14,030,763 (GRCm39) missense probably damaging 1.00
R1819:Afdn UTSW 17 14,071,110 (GRCm39) missense probably damaging 1.00
R1872:Afdn UTSW 17 14,101,578 (GRCm39) missense probably damaging 1.00
R1880:Afdn UTSW 17 14,072,615 (GRCm39) missense possibly damaging 0.84
R2049:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2140:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2142:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2162:Afdn UTSW 17 14,116,436 (GRCm39) missense probably benign 0.01
R2221:Afdn UTSW 17 14,103,999 (GRCm39) splice site probably benign
R2223:Afdn UTSW 17 14,103,999 (GRCm39) splice site probably benign
R2291:Afdn UTSW 17 14,109,153 (GRCm39) missense probably damaging 1.00
R2993:Afdn UTSW 17 14,111,262 (GRCm39) critical splice donor site probably null
R3402:Afdn UTSW 17 14,104,176 (GRCm39) missense probably damaging 1.00
R3403:Afdn UTSW 17 14,104,176 (GRCm39) missense probably damaging 1.00
R3690:Afdn UTSW 17 14,108,671 (GRCm39) missense probably damaging 1.00
R3691:Afdn UTSW 17 14,108,671 (GRCm39) missense probably damaging 1.00
R3764:Afdn UTSW 17 14,066,851 (GRCm39) missense probably benign 0.07
R3832:Afdn UTSW 17 14,116,436 (GRCm39) missense probably benign 0.01
R4002:Afdn UTSW 17 14,104,179 (GRCm39) missense probably damaging 1.00
R4440:Afdn UTSW 17 14,071,152 (GRCm39) missense probably damaging 1.00
R4621:Afdn UTSW 17 14,109,082 (GRCm39) missense probably damaging 1.00
R4935:Afdn UTSW 17 14,111,228 (GRCm39) missense probably benign 0.30
R5279:Afdn UTSW 17 14,109,214 (GRCm39) missense probably damaging 1.00
R5421:Afdn UTSW 17 14,052,668 (GRCm39) missense probably benign 0.25
R5689:Afdn UTSW 17 14,075,621 (GRCm39) missense probably damaging 1.00
R6332:Afdn UTSW 17 14,030,707 (GRCm39) missense possibly damaging 0.92
R6369:Afdn UTSW 17 14,055,605 (GRCm39) nonsense probably null
R6433:Afdn UTSW 17 14,101,561 (GRCm39) missense probably damaging 1.00
R6467:Afdn UTSW 17 14,024,315 (GRCm39) missense probably damaging 1.00
R6500:Afdn UTSW 17 14,042,634 (GRCm39) missense possibly damaging 0.67
R6564:Afdn UTSW 17 14,116,351 (GRCm39) missense probably benign
R6705:Afdn UTSW 17 14,108,283 (GRCm39) missense probably benign 0.01
R6733:Afdn UTSW 17 14,043,615 (GRCm39) missense probably benign 0.39
R6983:Afdn UTSW 17 14,101,583 (GRCm39) missense probably damaging 1.00
R7089:Afdn UTSW 17 14,111,074 (GRCm39) splice site probably null
R7161:Afdn UTSW 17 14,109,208 (GRCm39) missense possibly damaging 0.55
R7175:Afdn UTSW 17 14,108,869 (GRCm39) missense probably damaging 1.00
R7492:Afdn UTSW 17 14,068,638 (GRCm39) critical splice donor site probably null
R7567:Afdn UTSW 17 14,109,070 (GRCm39) missense probably benign 0.19
R7581:Afdn UTSW 17 14,069,500 (GRCm39) missense probably damaging 1.00
R7694:Afdn UTSW 17 14,109,144 (GRCm39) missense probably damaging 0.99
R7722:Afdn UTSW 17 14,029,231 (GRCm39) missense probably benign 0.40
R7794:Afdn UTSW 17 14,102,695 (GRCm39) missense probably damaging 1.00
R8039:Afdn UTSW 17 14,119,403 (GRCm39) missense probably damaging 0.99
R8444:Afdn UTSW 17 14,104,062 (GRCm39) missense probably benign 0.31
R8694:Afdn UTSW 17 14,108,641 (GRCm39) missense probably benign
R8728:Afdn UTSW 17 14,119,207 (GRCm39) missense probably damaging 1.00
R8770:Afdn UTSW 17 14,104,199 (GRCm39) critical splice donor site probably null
R8887:Afdn UTSW 17 14,116,401 (GRCm39) nonsense probably null
R9101:Afdn UTSW 17 14,043,706 (GRCm39) missense probably damaging 0.99
R9169:Afdn UTSW 17 14,072,627 (GRCm39) missense probably benign 0.02
R9275:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9276:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9277:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9278:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9281:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9573:Afdn UTSW 17 14,050,229 (GRCm39) missense probably damaging 1.00
R9619:Afdn UTSW 17 14,101,566 (GRCm39) missense probably damaging 1.00
R9746:Afdn UTSW 17 14,066,782 (GRCm39) missense probably benign 0.00
R9797:Afdn UTSW 17 14,066,562 (GRCm39) missense probably benign
X0060:Afdn UTSW 17 14,038,432 (GRCm39) nonsense probably null
X0064:Afdn UTSW 17 14,108,289 (GRCm39) missense possibly damaging 0.60
Z1088:Afdn UTSW 17 14,104,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGCCGCCTAGAAGCTGAGAG -3'
(R):5'- CCAAATGGCAGGGGTACAGAGATTC -3'

Sequencing Primer
(F):5'- ACTTCCACGGGACTATGAGC -3'
(R):5'- GAAAGGTCTGATTCACCATTCC -3'
Posted On 2013-05-09