Incidental Mutation 'R0226:Afdn'
ID 33964
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Name afadin, adherens junction formation factor
Synonyms Afadin, I-afadin, AF6, Mllt4, S-afadin, 5033403D15Rik
MMRRC Submission 038471-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0226 (G1)
Quality Score 190
Status Validated
Chromosome 17
Chromosomal Location 13760539-13906150 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13899146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1700 (T1700A)
Ref Sequence ENSEMBL: ENSMUSP00000128891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
AlphaFold Q9QZQ1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133422
Predicted Effect unknown
Transcript: ENSMUST00000137531
AA Change: T274A
SMART Domains Protein: ENSMUSP00000116711
Gene: ENSMUSG00000068036
AA Change: T274A

DomainStartEndE-ValueType
coiled coil region 70 110 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137708
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137784
AA Change: T1722A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: T1722A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139666
AA Change: T1715A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: T1715A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150848
AA Change: T1700A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: T1700A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170827
AA Change: T1700A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: T1700A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 13884628 missense probably damaging 1.00
IGL00784:Afdn APN 17 13849263 splice site probably benign
IGL00971:Afdn APN 17 13852313 splice site probably benign
IGL01403:Afdn APN 17 13903870 missense probably damaging 1.00
IGL01944:Afdn APN 17 13810481 missense probably damaging 1.00
IGL02474:Afdn APN 17 13818229 missense probably damaging 1.00
IGL02615:Afdn APN 17 13825976 missense probably benign 0.00
IGL02664:Afdn APN 17 13852466 splice site probably benign
IGL03036:Afdn APN 17 13888088 missense probably benign 0.12
jubilee UTSW 17 13887986 missense probably damaging 1.00
IGL03134:Afdn UTSW 17 13846286 missense probably benign 0.04
R0112:Afdn UTSW 17 13884637 missense probably damaging 1.00
R0305:Afdn UTSW 17 13888514 splice site probably null
R0310:Afdn UTSW 17 13885508 critical splice donor site probably null
R0711:Afdn UTSW 17 13852436 missense probably damaging 1.00
R0828:Afdn UTSW 17 13903998 missense probably damaging 1.00
R1268:Afdn UTSW 17 13887986 missense probably damaging 1.00
R1317:Afdn UTSW 17 13846273 missense probably benign 0.11
R1386:Afdn UTSW 17 13846536 missense probably damaging 1.00
R1438:Afdn UTSW 17 13855390 missense probably damaging 1.00
R1607:Afdn UTSW 17 13810501 missense probably damaging 1.00
R1819:Afdn UTSW 17 13850848 missense probably damaging 1.00
R1872:Afdn UTSW 17 13881316 missense probably damaging 1.00
R1880:Afdn UTSW 17 13852353 missense possibly damaging 0.84
R2049:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2140:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2142:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2162:Afdn UTSW 17 13896174 missense probably benign 0.01
R2221:Afdn UTSW 17 13883737 splice site probably benign
R2223:Afdn UTSW 17 13883737 splice site probably benign
R2291:Afdn UTSW 17 13888891 missense probably damaging 1.00
R2993:Afdn UTSW 17 13891000 critical splice donor site probably null
R3402:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3403:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3690:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3691:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3764:Afdn UTSW 17 13846589 missense probably benign 0.07
R3832:Afdn UTSW 17 13896174 missense probably benign 0.01
R4002:Afdn UTSW 17 13883917 missense probably damaging 1.00
R4440:Afdn UTSW 17 13850890 missense probably damaging 1.00
R4621:Afdn UTSW 17 13888820 missense probably damaging 1.00
R4935:Afdn UTSW 17 13890966 missense probably benign 0.30
R5279:Afdn UTSW 17 13888952 missense probably damaging 1.00
R5421:Afdn UTSW 17 13832406 missense probably benign 0.25
R5689:Afdn UTSW 17 13855359 missense probably damaging 1.00
R6332:Afdn UTSW 17 13810445 missense possibly damaging 0.92
R6369:Afdn UTSW 17 13835343 nonsense probably null
R6433:Afdn UTSW 17 13881299 missense probably damaging 1.00
R6467:Afdn UTSW 17 13804053 missense probably damaging 1.00
R6500:Afdn UTSW 17 13822372 missense possibly damaging 0.67
R6564:Afdn UTSW 17 13896089 missense probably benign
R6705:Afdn UTSW 17 13888021 missense probably benign 0.01
R6733:Afdn UTSW 17 13823353 missense probably benign 0.39
R6983:Afdn UTSW 17 13881321 missense probably damaging 1.00
R7089:Afdn UTSW 17 13890812 splice site probably null
R7161:Afdn UTSW 17 13888946 missense possibly damaging 0.55
R7175:Afdn UTSW 17 13888607 missense probably damaging 1.00
R7492:Afdn UTSW 17 13848376 critical splice donor site probably null
R7567:Afdn UTSW 17 13888808 missense probably benign 0.19
R7581:Afdn UTSW 17 13849238 missense probably damaging 1.00
R7694:Afdn UTSW 17 13888882 missense probably damaging 0.99
R7722:Afdn UTSW 17 13808969 missense probably benign 0.40
R7794:Afdn UTSW 17 13882433 missense probably damaging 1.00
R8039:Afdn UTSW 17 13899141 missense probably damaging 0.99
R8444:Afdn UTSW 17 13883800 missense probably benign 0.31
R8694:Afdn UTSW 17 13888379 missense probably benign
R8728:Afdn UTSW 17 13898945 missense probably damaging 1.00
R8770:Afdn UTSW 17 13883937 critical splice donor site probably null
R8887:Afdn UTSW 17 13896139 nonsense probably null
R9101:Afdn UTSW 17 13823444 missense probably damaging 0.99
R9169:Afdn UTSW 17 13852365 missense probably benign 0.02
R9275:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9276:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9277:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9278:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9281:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9573:Afdn UTSW 17 13829967 missense probably damaging 1.00
R9619:Afdn UTSW 17 13881304 missense probably damaging 1.00
R9746:Afdn UTSW 17 13846520 missense probably benign 0.00
R9797:Afdn UTSW 17 13846300 missense probably benign
X0060:Afdn UTSW 17 13818170 nonsense probably null
X0064:Afdn UTSW 17 13888027 missense possibly damaging 0.60
Z1088:Afdn UTSW 17 13883780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGCCGCCTAGAAGCTGAGAG -3'
(R):5'- CCAAATGGCAGGGGTACAGAGATTC -3'

Sequencing Primer
(F):5'- ACTTCCACGGGACTATGAGC -3'
(R):5'- GAAAGGTCTGATTCACCATTCC -3'
Posted On 2013-05-09