Incidental Mutation 'R0226:Unkl'
ID33965
Institutional Source Beutler Lab
Gene Symbol Unkl
Ensembl Gene ENSMUSG00000015127
Gene Nameunkempt family like zinc finger
Synonyms
MMRRC Submission 038471-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R0226 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25188397-25234443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25230711 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 469 (I469N)
Ref Sequence ENSEMBL: ENSMUSP00000124276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015271] [ENSMUST00000038973] [ENSMUST00000039734] [ENSMUST00000115154] [ENSMUST00000160896] [ENSMUST00000161679] [ENSMUST00000162498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015271
AA Change: I167N

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015271
Gene: ENSMUSG00000015127
AA Change: I167N

DomainStartEndE-ValueType
coiled coil region 73 154 N/A INTRINSIC
RING 198 232 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038973
SMART Domains Protein: ENSMUSP00000042073
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 152 1.4e-10 PFAM
DMAP_binding 176 278 2.55e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000039734
AA Change: I655N

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039670
Gene: ENSMUSG00000015127
AA Change: I655N

DomainStartEndE-ValueType
low complexity region 61 69 N/A INTRINSIC
ZnF_C3H1 76 103 1.33e-1 SMART
Blast:ZnF_C3H1 115 144 7e-13 BLAST
ZnF_C3H1 207 232 2.49e1 SMART
ZnF_C3H1 243 276 9.28e-1 SMART
ZnF_C3H1 285 312 8.47e-4 SMART
low complexity region 371 412 N/A INTRINSIC
low complexity region 463 495 N/A INTRINSIC
low complexity region 499 505 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
coiled coil region 561 642 N/A INTRINSIC
RING 686 720 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115154
SMART Domains Protein: ENSMUSP00000110807
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 151 3.9e-11 PFAM
DMAP_binding 183 285 2.55e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160896
AA Change: I469N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124276
Gene: ENSMUSG00000015127
AA Change: I469N

DomainStartEndE-ValueType
ZnF_C3H1 21 46 2.49e1 SMART
ZnF_C3H1 57 90 9.28e-1 SMART
ZnF_C3H1 99 126 8.47e-4 SMART
low complexity region 185 226 N/A INTRINSIC
low complexity region 277 309 N/A INTRINSIC
low complexity region 313 319 N/A INTRINSIC
low complexity region 325 341 N/A INTRINSIC
coiled coil region 375 456 N/A INTRINSIC
RING 500 534 4.13e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161679
AA Change: I159N

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125294
Gene: ENSMUSG00000015127
AA Change: I159N

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 15 31 N/A INTRINSIC
coiled coil region 65 146 N/A INTRINSIC
RING 190 224 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162498
SMART Domains Protein: ENSMUSP00000124530
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 51 83 N/A INTRINSIC
low complexity region 87 93 N/A INTRINSIC
Meta Mutation Damage Score 0.5414 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING finger protein that may function in Rac signaling. It can bind to Brg/Brm-associated factor 60b and can promote its ubiquitination. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Unkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Unkl APN 17 25210848 missense probably benign 0.00
IGL02011:Unkl APN 17 25218591 missense probably damaging 1.00
IGL02141:Unkl APN 17 25229434 missense probably damaging 1.00
R0394:Unkl UTSW 17 25230777 critical splice donor site probably null
R0638:Unkl UTSW 17 25208083 splice site probably benign
R1364:Unkl UTSW 17 25189623 missense probably benign
R1596:Unkl UTSW 17 25205733 missense probably null 1.00
R1899:Unkl UTSW 17 25229460 splice site probably null
R1960:Unkl UTSW 17 25209645 splice site probably benign
R3774:Unkl UTSW 17 25188407 splice site probably null
R3927:Unkl UTSW 17 25229329 missense probably damaging 0.99
R5164:Unkl UTSW 17 25213109 splice site probably null
R5481:Unkl UTSW 17 25201172 nonsense probably null
R5520:Unkl UTSW 17 25205610 missense probably damaging 1.00
R5559:Unkl UTSW 17 25205713 missense probably benign 0.00
R6267:Unkl UTSW 17 25231865 makesense probably null
R6296:Unkl UTSW 17 25231865 makesense probably null
R6883:Unkl UTSW 17 25230333 missense probably damaging 1.00
R6979:Unkl UTSW 17 25199916 missense probably damaging 1.00
R7752:Unkl UTSW 17 25218653 missense probably damaging 1.00
R7901:Unkl UTSW 17 25218653 missense probably damaging 1.00
R8712:Unkl UTSW 17 25231715 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCAGGCAATGGGAAGAATCTTGGC -3'
(R):5'- TCAATGGGACACATTCGAGAAGCAC -3'

Sequencing Primer
(F):5'- TCTTGGCAGCAAGTGAAGC -3'
(R):5'- TCCAGGCAAGGAGCCAG -3'
Posted On2013-05-09