Incidental Mutation 'R0226:Treml1'
ID 33967
Institutional Source Beutler Lab
Gene Symbol Treml1
Ensembl Gene ENSMUSG00000023993
Gene Name triggering receptor expressed on myeloid cells-like 1
Synonyms 5430401J17Rik, TLT-1
MMRRC Submission 038471-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0226 (G1)
Quality Score 82
Status Validated
Chromosome 17
Chromosomal Location 48359916-48367176 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48360458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 124 (L124F)
Ref Sequence ENSEMBL: ENSMUSP00000153104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024792] [ENSMUST00000223956] [ENSMUST00000224001] [ENSMUST00000225849]
AlphaFold Q8K558
Predicted Effect probably damaging
Transcript: ENSMUST00000024792
AA Change: L124F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024792
Gene: ENSMUSG00000023993
AA Change: L124F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 24 124 2.83e-3 SMART
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223968
Predicted Effect probably damaging
Transcript: ENSMUST00000224001
AA Change: L124F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225849
AA Change: L124F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the triggering receptor expressed on myeloid cells-like (TREM) family. The encoded protein is a type 1 single Ig domain orphan receptor localized to the alpha-granule membranes of platelets. The encoded protein is involved in platelet aggregation, inflammation, and cellular activation and has been linked to Gray platelet syndrome. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduced platelet count, defective platelet aggregation, prolonged bleeding times, enhanced inflammatory hemorrhage, and increased susceptibility to death from endotoxin (LPS) challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Treml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Treml1 APN 17 48365599 splice site probably benign
IGL01868:Treml1 APN 17 48366007 missense probably benign 0.41
IGL02543:Treml1 APN 17 48360431 missense possibly damaging 0.93
IGL03136:Treml1 APN 17 48364851 splice site probably benign
IGL03242:Treml1 APN 17 48365988 splice site probably benign
R0047:Treml1 UTSW 17 48364980 nonsense probably null
R0047:Treml1 UTSW 17 48364980 nonsense probably null
R1385:Treml1 UTSW 17 48360198 missense probably damaging 1.00
R1602:Treml1 UTSW 17 48364889 missense probably damaging 0.97
R4379:Treml1 UTSW 17 48360396 missense probably damaging 1.00
R4865:Treml1 UTSW 17 48366857 missense probably benign 0.00
R5837:Treml1 UTSW 17 48360152 missense possibly damaging 0.74
R7102:Treml1 UTSW 17 48366672 missense probably damaging 0.98
R7107:Treml1 UTSW 17 48360219 missense probably damaging 1.00
R7442:Treml1 UTSW 17 48366691 missense probably damaging 1.00
R7825:Treml1 UTSW 17 48366756 missense probably damaging 1.00
R8843:Treml1 UTSW 17 48366824 missense probably damaging 1.00
R8997:Treml1 UTSW 17 48360438 missense probably damaging 1.00
R9229:Treml1 UTSW 17 48366746 missense probably benign
R9510:Treml1 UTSW 17 48366743 missense probably damaging 0.96
R9619:Treml1 UTSW 17 48364978 missense probably benign 0.12
RF058:Treml1 UTSW 17 48359947 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATTCTAGTGCAGTGCCACTACC -3'
(R):5'- ACAGTTCCGTTGCCACTCAGTC -3'

Sequencing Primer
(F):5'- ACTAGTGACCTCAGCGGTG -3'
(R):5'- ACTCAGTCCAGGACGAGC -3'
Posted On 2013-05-09