Incidental Mutation 'R0226:Treml1'
ID 33967
Institutional Source Beutler Lab
Gene Symbol Treml1
Ensembl Gene ENSMUSG00000023993
Gene Name triggering receptor expressed on myeloid cells-like 1
Synonyms TLT-1, 5430401J17Rik
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0226 (G1)
Quality Score 82
Status Validated
Chromosome 17
Chromosomal Location 48666944-48674204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48667486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 124 (L124F)
Ref Sequence ENSEMBL: ENSMUSP00000153104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024792] [ENSMUST00000223956] [ENSMUST00000224001] [ENSMUST00000225849]
AlphaFold Q8K558
Predicted Effect probably damaging
Transcript: ENSMUST00000024792
AA Change: L124F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024792
Gene: ENSMUSG00000023993
AA Change: L124F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 24 124 2.83e-3 SMART
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223968
Predicted Effect probably damaging
Transcript: ENSMUST00000224001
AA Change: L124F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225849
AA Change: L124F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the triggering receptor expressed on myeloid cells-like (TREM) family. The encoded protein is a type 1 single Ig domain orphan receptor localized to the alpha-granule membranes of platelets. The encoded protein is involved in platelet aggregation, inflammation, and cellular activation and has been linked to Gray platelet syndrome. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduced platelet count, defective platelet aggregation, prolonged bleeding times, enhanced inflammatory hemorrhage, and increased susceptibility to death from endotoxin (LPS) challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Aasdh A T 5: 77,049,849 (GRCm39) L49Q probably damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Ablim1 A T 19: 57,032,302 (GRCm39) L556Q probably damaging Het
Afdn A G 17: 14,119,408 (GRCm39) T1700A probably benign Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Agpat3 T A 10: 78,113,863 (GRCm39) H275L possibly damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Aim2 A G 1: 173,289,899 (GRCm39) probably benign Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fbn1 C T 2: 125,162,830 (GRCm39) R2152Q possibly damaging Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Rnf43 A T 11: 87,622,263 (GRCm39) S455C probably damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp277 A G 12: 40,414,161 (GRCm39) L228S possibly damaging Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Treml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Treml1 APN 17 48,672,627 (GRCm39) splice site probably benign
IGL01868:Treml1 APN 17 48,673,035 (GRCm39) missense probably benign 0.41
IGL02543:Treml1 APN 17 48,667,459 (GRCm39) missense possibly damaging 0.93
IGL03136:Treml1 APN 17 48,671,879 (GRCm39) splice site probably benign
IGL03242:Treml1 APN 17 48,673,016 (GRCm39) splice site probably benign
R0047:Treml1 UTSW 17 48,672,008 (GRCm39) nonsense probably null
R0047:Treml1 UTSW 17 48,672,008 (GRCm39) nonsense probably null
R1385:Treml1 UTSW 17 48,667,226 (GRCm39) missense probably damaging 1.00
R1602:Treml1 UTSW 17 48,671,917 (GRCm39) missense probably damaging 0.97
R4379:Treml1 UTSW 17 48,667,424 (GRCm39) missense probably damaging 1.00
R4865:Treml1 UTSW 17 48,673,885 (GRCm39) missense probably benign 0.00
R5837:Treml1 UTSW 17 48,667,180 (GRCm39) missense possibly damaging 0.74
R7102:Treml1 UTSW 17 48,673,700 (GRCm39) missense probably damaging 0.98
R7107:Treml1 UTSW 17 48,667,247 (GRCm39) missense probably damaging 1.00
R7442:Treml1 UTSW 17 48,673,719 (GRCm39) missense probably damaging 1.00
R7825:Treml1 UTSW 17 48,673,784 (GRCm39) missense probably damaging 1.00
R8843:Treml1 UTSW 17 48,673,852 (GRCm39) missense probably damaging 1.00
R8997:Treml1 UTSW 17 48,667,466 (GRCm39) missense probably damaging 1.00
R9229:Treml1 UTSW 17 48,673,774 (GRCm39) missense probably benign
R9510:Treml1 UTSW 17 48,673,771 (GRCm39) missense probably damaging 0.96
R9619:Treml1 UTSW 17 48,672,006 (GRCm39) missense probably benign 0.12
RF058:Treml1 UTSW 17 48,666,975 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATTCTAGTGCAGTGCCACTACC -3'
(R):5'- ACAGTTCCGTTGCCACTCAGTC -3'

Sequencing Primer
(F):5'- ACTAGTGACCTCAGCGGTG -3'
(R):5'- ACTCAGTCCAGGACGAGC -3'
Posted On 2013-05-09