Incidental Mutation 'R0226:Ablim1'
ID 33976
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Name actin-binding LIM protein 1
Synonyms 4833406P10Rik, 9330196J19Rik, 2610209L21Rik, Limab1, 2210411C18Rik, abLIM-S, abLIM-M, abLIM-L
MMRRC Submission 038471-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R0226 (G1)
Quality Score 167
Status Validated
Chromosome 19
Chromosomal Location 57021165-57303351 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57032302 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 556 (L556Q)
Ref Sequence ENSEMBL: ENSMUSP00000107184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000104902] [ENSMUST00000111526] [ENSMUST00000111528] [ENSMUST00000111529] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111559] [ENSMUST00000111558]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000079360
AA Change: L703Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085
AA Change: L703Q

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099294
AA Change: L496Q

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085
AA Change: L496Q

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000104902
AA Change: L387Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127818
Gene: ENSMUSG00000025085
AA Change: L387Q

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 1e-8 PDB
low complexity region 88 97 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
coiled coil region 358 382 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
VHP 510 545 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111526
AA Change: L242Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107151
Gene: ENSMUSG00000025085
AA Change: L242Q

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
PDB:1WIG|A 1 28 6e-9 PDB
coiled coil region 213 237 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
VHP 365 400 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111528
AA Change: L296Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107153
Gene: ENSMUSG00000025085
AA Change: L296Q

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 72 81 N/A INTRINSIC
coiled coil region 267 291 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
VHP 419 454 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111529
AA Change: L268Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107154
Gene: ENSMUSG00000025085
AA Change: L268Q

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 44 53 N/A INTRINSIC
coiled coil region 239 263 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
VHP 391 426 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111544
AA Change: L510Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085
AA Change: L510Q

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111546
AA Change: L543Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085
AA Change: L543Q

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111550
AA Change: L524Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085
AA Change: L524Q

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111555
AA Change: L619Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085
AA Change: L619Q

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111559
AA Change: L556Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085
AA Change: L556Q

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111558
AA Change: L586Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085
AA Change: L586Q

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127198
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,379,569 (GRCm39) T54K possibly damaging Het
2210408I21Rik A T 13: 77,451,544 (GRCm39) E876V possibly damaging Het
Aasdh A T 5: 77,049,849 (GRCm39) L49Q probably damaging Het
Abca8b T C 11: 109,847,844 (GRCm39) probably null Het
Afdn A G 17: 14,119,408 (GRCm39) T1700A probably benign Het
Agl G A 3: 116,545,720 (GRCm39) R1359C probably damaging Het
Agpat3 T A 10: 78,113,863 (GRCm39) H275L possibly damaging Het
Ahcyl1 A T 3: 107,577,586 (GRCm39) C180* probably null Het
Aim2 A G 1: 173,289,899 (GRCm39) probably benign Het
Angpt1 T C 15: 42,331,631 (GRCm39) N320S probably benign Het
Ankrd52 T A 10: 128,225,727 (GRCm39) probably null Het
Ap1g1 C T 8: 110,581,694 (GRCm39) S654L probably benign Het
Bpifa1 T A 2: 153,987,977 (GRCm39) S173R probably benign Het
Brd8 T C 18: 34,736,947 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qtnf2 A G 11: 43,381,670 (GRCm39) T161A probably benign Het
Car6 T C 4: 150,271,965 (GRCm39) Y228C probably damaging Het
Ccdc149 A G 5: 52,557,559 (GRCm39) L273P probably damaging Het
Cit G A 5: 116,122,899 (GRCm39) R1405Q probably damaging Het
Cox17 T C 16: 38,169,638 (GRCm39) L48P probably damaging Het
Cttn A G 7: 143,995,589 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,743,619 (GRCm39) probably benign Het
Dtnbp1 A G 13: 45,076,669 (GRCm39) L175P probably damaging Het
Efl1 T C 7: 82,342,219 (GRCm39) probably benign Het
Fbn1 C T 2: 125,162,830 (GRCm39) R2152Q possibly damaging Het
Fignl1 A T 11: 11,751,061 (GRCm39) S665T probably benign Het
Gm9843 A T 16: 76,200,449 (GRCm39) noncoding transcript Het
Gpr155 C T 2: 73,197,936 (GRCm39) V395I probably benign Het
Greb1l T C 18: 10,522,076 (GRCm39) probably benign Het
Hdgfl1 A T 13: 26,953,979 (GRCm39) H31Q probably benign Het
Heatr1 T C 13: 12,425,443 (GRCm39) S628P probably damaging Het
Hivep2 A G 10: 14,005,456 (GRCm39) T685A probably benign Het
Hmgcl T G 4: 135,686,039 (GRCm39) V168G probably damaging Het
Itch T C 2: 155,041,314 (GRCm39) I454T probably benign Het
Itih2 T C 2: 10,120,110 (GRCm39) D309G possibly damaging Het
Kcmf1 T C 6: 72,819,935 (GRCm39) I304V probably benign Het
Kcnh1 G A 1: 191,959,112 (GRCm39) W222* probably null Het
Kcnh1 G T 1: 191,959,113 (GRCm39) W222C probably damaging Het
Kif24 T A 4: 41,414,939 (GRCm39) K287* probably null Het
Lrig3 A G 10: 125,807,986 (GRCm39) probably benign Het
Lrp2 A T 2: 69,367,907 (GRCm39) C202S probably null Het
Lrrc37 A T 11: 103,494,067 (GRCm39) F663L probably benign Het
Lrrn2 A G 1: 132,865,558 (GRCm39) N208D probably damaging Het
Mcm5 C T 8: 75,852,880 (GRCm39) T664I possibly damaging Het
Mfsd10 A G 5: 34,791,790 (GRCm39) L365S probably benign Het
Mfsd6 A G 1: 52,697,849 (GRCm39) probably benign Het
Mgat4e A G 1: 134,468,841 (GRCm39) V401A probably benign Het
Mllt3 C A 4: 87,758,969 (GRCm39) V360L probably benign Het
Mrm1 G A 11: 84,709,996 (GRCm39) A68V possibly damaging Het
Myo19 A G 11: 84,788,558 (GRCm39) probably benign Het
Myo3b A G 2: 70,047,510 (GRCm39) T311A probably benign Het
Myo5b T C 18: 74,875,251 (GRCm39) F1552L probably benign Het
Myo7b C T 18: 32,105,949 (GRCm39) V1353I probably benign Het
Myo9b T C 8: 71,806,476 (GRCm39) S1512P probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Osbpl3 A G 6: 50,329,988 (GRCm39) W63R probably damaging Het
Pcdh17 T C 14: 84,685,641 (GRCm39) S703P probably damaging Het
Pclo T C 5: 14,815,237 (GRCm39) I1231T probably damaging Het
Pex16 A C 2: 92,206,032 (GRCm39) probably benign Het
Pfkl T C 10: 77,828,368 (GRCm39) N399S probably benign Het
Pkhd1l1 G A 15: 44,390,180 (GRCm39) R1432K possibly damaging Het
Prdm1 T A 10: 44,332,692 (GRCm39) T106S probably benign Het
Prrc1 A G 18: 57,496,363 (GRCm39) M105V probably benign Het
Psg26 A G 7: 18,217,883 (GRCm39) C12R possibly damaging Het
Rnf43 A T 11: 87,622,263 (GRCm39) S455C probably damaging Het
Ryr2 T C 13: 11,787,442 (GRCm39) K977R probably damaging Het
Sart1 C T 19: 5,431,150 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,998,167 (GRCm39) S509G probably benign Het
Sin3b A T 8: 73,471,136 (GRCm39) E361V probably benign Het
Slc35e3 C T 10: 117,576,795 (GRCm39) E179K possibly damaging Het
Sntb2 T C 8: 107,728,215 (GRCm39) S388P probably damaging Het
Srms A G 2: 180,854,175 (GRCm39) S131P probably benign Het
Sting1 A T 18: 35,872,141 (GRCm39) F120L probably benign Het
Stxbp5 T C 10: 9,742,442 (GRCm39) probably benign Het
Taar2 T C 10: 23,816,961 (GRCm39) V167A probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Thsd7a A G 6: 12,321,899 (GRCm39) Y1516H possibly damaging Het
Tlk1 T A 2: 70,544,513 (GRCm39) probably benign Het
Tnfaip3 T C 10: 18,878,495 (GRCm39) K771R probably damaging Het
Treml1 C T 17: 48,667,486 (GRCm39) L124F probably damaging Het
Ttn G T 2: 76,611,141 (GRCm39) Q9137K possibly damaging Het
Unkl T A 17: 25,449,685 (GRCm39) I469N probably damaging Het
Vmn1r173 G T 7: 23,402,508 (GRCm39) V248L possibly damaging Het
Vps35 T C 8: 86,000,204 (GRCm39) Q474R probably damaging Het
Wdr17 T A 8: 55,116,043 (GRCm39) T580S probably benign Het
Xpnpep1 T C 19: 52,998,583 (GRCm39) K222E probably benign Het
Ylpm1 A G 12: 85,096,511 (GRCm39) T1446A probably benign Het
Zfp277 A G 12: 40,414,161 (GRCm39) L228S possibly damaging Het
Zfp941 T A 7: 140,393,188 (GRCm39) K57M probably damaging Het
Zmpste24 A T 4: 120,938,406 (GRCm39) S244R probably benign Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57,056,618 (GRCm39) missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57,056,618 (GRCm39) missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57,056,618 (GRCm39) missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57,140,722 (GRCm39) missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57,049,760 (GRCm39) missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57,204,153 (GRCm39) missense probably benign
IGL01385:Ablim1 APN 19 57,057,346 (GRCm39) missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57,027,879 (GRCm39) missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57,123,086 (GRCm39) missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57,068,312 (GRCm39) splice site probably benign
IGL02498:Ablim1 APN 19 57,140,751 (GRCm39) nonsense probably null
A9681:Ablim1 UTSW 19 57,161,755 (GRCm39) critical splice donor site probably null
R0089:Ablim1 UTSW 19 57,031,463 (GRCm39) missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57,123,065 (GRCm39) missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57,056,668 (GRCm39) missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57,071,979 (GRCm39) start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57,071,979 (GRCm39) start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57,204,397 (GRCm39) start gained probably null
R1936:Ablim1 UTSW 19 57,204,397 (GRCm39) start gained probably null
R2021:Ablim1 UTSW 19 57,035,450 (GRCm39) missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57,032,245 (GRCm39) missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57,065,863 (GRCm39) missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57,140,791 (GRCm39) missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57,140,735 (GRCm39) missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57,037,892 (GRCm39) critical splice donor site probably null
R3732:Ablim1 UTSW 19 57,037,892 (GRCm39) critical splice donor site probably null
R3733:Ablim1 UTSW 19 57,037,892 (GRCm39) critical splice donor site probably null
R3734:Ablim1 UTSW 19 57,037,892 (GRCm39) critical splice donor site probably null
R3878:Ablim1 UTSW 19 57,025,642 (GRCm39) splice site probably null
R4354:Ablim1 UTSW 19 57,143,710 (GRCm39) missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57,065,874 (GRCm39) missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57,204,153 (GRCm39) missense probably benign
R4860:Ablim1 UTSW 19 57,068,298 (GRCm39) missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57,068,298 (GRCm39) missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57,062,285 (GRCm39) critical splice donor site probably null
R5277:Ablim1 UTSW 19 57,143,693 (GRCm39) missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57,143,681 (GRCm39) missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57,119,355 (GRCm39) missense probably benign 0.07
R5893:Ablim1 UTSW 19 57,204,285 (GRCm39) missense probably benign 0.07
R5958:Ablim1 UTSW 19 57,030,367 (GRCm39) missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57,049,787 (GRCm39) missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57,068,271 (GRCm39) missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57,119,284 (GRCm39) missense probably benign 0.03
R6662:Ablim1 UTSW 19 57,062,285 (GRCm39) critical splice donor site probably null
R6705:Ablim1 UTSW 19 57,204,253 (GRCm39) missense probably benign 0.01
R7111:Ablim1 UTSW 19 57,062,309 (GRCm39) missense probably benign 0.05
R7291:Ablim1 UTSW 19 57,204,340 (GRCm39) missense probably benign
R7363:Ablim1 UTSW 19 57,204,173 (GRCm39) missense probably benign 0.10
R7901:Ablim1 UTSW 19 57,119,434 (GRCm39) splice site probably null
R7974:Ablim1 UTSW 19 57,033,405 (GRCm39) critical splice acceptor site probably null
R8079:Ablim1 UTSW 19 57,170,656 (GRCm39) critical splice donor site probably null
R8087:Ablim1 UTSW 19 57,170,688 (GRCm39) missense
R8120:Ablim1 UTSW 19 57,035,360 (GRCm39) missense probably benign 0.00
R8277:Ablim1 UTSW 19 57,204,351 (GRCm39) missense probably benign 0.10
R8339:Ablim1 UTSW 19 57,032,281 (GRCm39) missense probably benign 0.00
R8536:Ablim1 UTSW 19 57,170,718 (GRCm39) intron probably benign
R8857:Ablim1 UTSW 19 57,119,287 (GRCm39) missense possibly damaging 0.84
R8875:Ablim1 UTSW 19 57,119,386 (GRCm39) missense probably benign 0.00
R8983:Ablim1 UTSW 19 57,227,644 (GRCm39) missense probably benign 0.02
R9055:Ablim1 UTSW 19 57,030,398 (GRCm39) missense probably benign 0.10
R9475:Ablim1 UTSW 19 57,227,612 (GRCm39) missense probably benign 0.00
R9505:Ablim1 UTSW 19 57,185,782 (GRCm39) intron probably benign
R9695:Ablim1 UTSW 19 57,170,739 (GRCm39) missense
R9762:Ablim1 UTSW 19 57,025,691 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTACCTCTGGACAGGGCAATC -3'
(R):5'- TGAAGCCTAGCACTGGAAAGCTAAC -3'

Sequencing Primer
(F):5'- CTGGACAGGGCAATCTATTTTAAGC -3'
(R):5'- CTGGAAAGCTAACAGGGCTTC -3'
Posted On 2013-05-09