Mutagenetix > Incidental Mutation

Incidental Mutation 'R0227:Raph1'

33977

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

038472-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R0227 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60525977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 117 (V117A)

Ref Sequence

ENSEMBL: ENSMUSP00000120638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485] [ENSMUST00000142258]

AlphaFold

F2Z3U3

Predicted Effect

probably benign
Transcript: ENSMUST00000027168
AA Change: V117A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: V117A

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090293
AA Change: V117A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: V117A

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122243

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127573

SMART Domains

Protein: ENSMUSP00000114596
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
coiled coil region	295	320	N/A	INTRINSIC
RA	322	408	1e-15	SMART
PH	450	560	1.6e-13	SMART
low complexity region	581	604	N/A	INTRINSIC
low complexity region	656	661	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: V117A

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: V117A

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142258
AA Change: V117A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120638
Gene: ENSMUSG00000026014
AA Change: V117A

Domain	Start	End	E-Value	Type
low complexity region	202	212	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.5%

Validation Efficiency

86% (37/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430038I01Rik	A	T	7: 137,387,709		probably benign	Het
Ankrd12	T	A	17: 65,987,227	T404S	probably benign	Het
Ap4m1	T	C	5: 138,176,276		probably benign	Het
Atn1	A	T	6: 124,746,930		probably benign	Het
Bcl9l	A	G	9: 44,505,236	Y202C	possibly damaging	Het
Ceacam18	G	T	7: 43,639,391	G189C	probably damaging	Het
Cfap65	C	T	1: 74,931,958	W67*	probably null	Het
Col2a1	C	T	15: 97,976,755	E1334K	unknown	Het
Crim1	A	G	17: 78,344,509		probably benign	Het
Csmd1	A	G	8: 16,391,822	S343P	probably benign	Het
D430041D05Rik	G	T	2: 104,205,200	D1594E	possibly damaging	Het
Dgcr14	C	T	16: 17,902,271	V406I	probably damaging	Het
Fam19a5	T	C	15: 87,720,490		probably benign	Het
Gcm2	C	T	13: 41,105,856	V46M	probably damaging	Het
Gm3486	A	T	14: 41,484,561	V185E	probably benign	Het
Gtf3a	C	A	5: 146,955,389	R317S	probably damaging	Het
Ice2	A	G	9: 69,412,228	I320V	probably benign	Het
Jag1	A	G	2: 137,115,618	V58A	probably benign	Het
Macf1	T	C	4: 123,399,391	E1241G	probably benign	Het
Mogat2	T	A	7: 99,223,132	I171F	probably benign	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myo1c	A	T	11: 75,658,694	Y201F	probably benign	Het
Myo9b	A	G	8: 71,344,162	I884V	probably damaging	Het
Nudt9	T	C	5: 104,061,675	I264T	possibly damaging	Het
Olfr948	A	G	9: 39,318,678	V312A	probably benign	Het
Pdcd11	AGAGGAGGAGGAGGAGGAGGAGGAG	AGAGGAGGAGGAGGAGGAGGAG	19: 47,113,437		probably benign	Het
Rabgef1	T	C	5: 130,190,990	V98A	probably damaging	Het
Raly	A	G	2: 154,865,921	D287G	probably damaging	Het
Slc34a2	T	C	5: 53,069,626	F697S	possibly damaging	Het
Son	T	A	16: 91,656,873	M836K	probably damaging	Het
Spock1	T	C	13: 57,440,477	M258V	possibly damaging	Het
Stk10	G	T	11: 32,617,859	C887F	probably damaging	Het
Synpo2	A	G	3: 123,113,793	S625P	probably benign	Het
Synrg	T	A	11: 84,009,432	D821E	probably damaging	Het
Tg	C	A	15: 66,698,446	A1389E	possibly damaging	Het
Tspan33	G	A	6: 29,713,478	V134M	probably damaging	Het
Ubr4	T	C	4: 139,431,649	F2438L	probably benign	Het
Vmn1r210	C	T	13: 22,827,391	V242I	probably benign	Het
Vmn1r63	C	T	7: 5,802,742	W297*	probably null	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Zic5	A	G	14: 122,459,661	I514T	unknown	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- CGCGCTTCAGCATCACTCACAG -3'
(R):5'- CATGGAGTAGTACAAGGTGTTTTCAGCA -3'

Sequencing Primer
(F):5'- TTCTACCAGAGATTGCTGAGC -3'
(R):5'- TGGCTGACCTCTGCTCTATA -3'

Posted On

2013-05-09