Incidental Mutation 'R0227:Raly'
ID33982
Institutional Source Beutler Lab
Gene Symbol Raly
Ensembl Gene ENSMUSG00000027593
Gene NamehnRNP-associated with lethal yellow
SynonymsMerc
MMRRC Submission 038472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0227 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154791096-154867261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154865921 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 287 (D287G)
Ref Sequence ENSEMBL: ENSMUSP00000105323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029120] [ENSMUST00000058089] [ENSMUST00000109701] [ENSMUST00000116389] [ENSMUST00000125872] [ENSMUST00000129137] [ENSMUST00000137333] [ENSMUST00000140713]
Predicted Effect probably damaging
Transcript: ENSMUST00000029120
AA Change: D303G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029120
Gene: ENSMUSG00000027593
AA Change: D303G

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
low complexity region 287 301 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058089
AA Change: D287G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058105
Gene: ENSMUSG00000027593
AA Change: D287G

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 117 144 N/A INTRINSIC
low complexity region 211 243 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109701
AA Change: D287G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105323
Gene: ENSMUSG00000027593
AA Change: D287G

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 117 144 N/A INTRINSIC
low complexity region 211 243 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116389
AA Change: D303G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112090
Gene: ENSMUSG00000027593
AA Change: D303G

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
low complexity region 287 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125872
SMART Domains Protein: ENSMUSP00000119108
Gene: ENSMUSG00000027593

DomainStartEndE-ValueType
RRM 22 88 1.6e-16 SMART
low complexity region 120 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129137
SMART Domains Protein: ENSMUSP00000114185
Gene: ENSMUSG00000027593

DomainStartEndE-ValueType
RRM 22 88 1.6e-16 SMART
low complexity region 117 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137333
SMART Domains Protein: ENSMUSP00000122261
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 70 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140713
SMART Domains Protein: ENSMUSP00000119126
Gene: ENSMUSG00000027593

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
Meta Mutation Damage Score 0.0651 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 86% (37/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) gene family. This protein may play a role in pre-mRNA splicing and in embryonic development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,387,709 probably benign Het
Ankrd12 T A 17: 65,987,227 T404S probably benign Het
Ap4m1 T C 5: 138,176,276 probably benign Het
Atn1 A T 6: 124,746,930 probably benign Het
Bcl9l A G 9: 44,505,236 Y202C possibly damaging Het
Ceacam18 G T 7: 43,639,391 G189C probably damaging Het
Cfap65 C T 1: 74,931,958 W67* probably null Het
Col2a1 C T 15: 97,976,755 E1334K unknown Het
Crim1 A G 17: 78,344,509 probably benign Het
Csmd1 A G 8: 16,391,822 S343P probably benign Het
D430041D05Rik G T 2: 104,205,200 D1594E possibly damaging Het
Dgcr14 C T 16: 17,902,271 V406I probably damaging Het
Fam19a5 T C 15: 87,720,490 probably benign Het
Gcm2 C T 13: 41,105,856 V46M probably damaging Het
Gm3486 A T 14: 41,484,561 V185E probably benign Het
Gtf3a C A 5: 146,955,389 R317S probably damaging Het
Ice2 A G 9: 69,412,228 I320V probably benign Het
Jag1 A G 2: 137,115,618 V58A probably benign Het
Macf1 T C 4: 123,399,391 E1241G probably benign Het
Mogat2 T A 7: 99,223,132 I171F probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myo1c A T 11: 75,658,694 Y201F probably benign Het
Myo9b A G 8: 71,344,162 I884V probably damaging Het
Nudt9 T C 5: 104,061,675 I264T possibly damaging Het
Olfr948 A G 9: 39,318,678 V312A probably benign Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Rabgef1 T C 5: 130,190,990 V98A probably damaging Het
Raph1 A G 1: 60,525,977 V117A probably benign Het
Slc34a2 T C 5: 53,069,626 F697S possibly damaging Het
Son T A 16: 91,656,873 M836K probably damaging Het
Spock1 T C 13: 57,440,477 M258V possibly damaging Het
Stk10 G T 11: 32,617,859 C887F probably damaging Het
Synpo2 A G 3: 123,113,793 S625P probably benign Het
Synrg T A 11: 84,009,432 D821E probably damaging Het
Tg C A 15: 66,698,446 A1389E possibly damaging Het
Tspan33 G A 6: 29,713,478 V134M probably damaging Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Vmn1r210 C T 13: 22,827,391 V242I probably benign Het
Vmn1r63 C T 7: 5,802,742 W297* probably null Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zic5 A G 14: 122,459,661 I514T unknown Het
Other mutations in Raly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Raly APN 2 154859670 splice site probably benign
IGL02164:Raly APN 2 154859929 nonsense probably null
R1412:Raly UTSW 2 154857395 missense possibly damaging 0.95
R1416:Raly UTSW 2 154857353 nonsense probably null
R2247:Raly UTSW 2 154864033 missense possibly damaging 0.92
R4110:Raly UTSW 2 154857458 nonsense probably null
R4533:Raly UTSW 2 154865933 missense probably damaging 0.98
R4654:Raly UTSW 2 154857456 missense probably damaging 1.00
R4866:Raly UTSW 2 154861896 missense probably damaging 0.99
R5395:Raly UTSW 2 154864007 unclassified probably null
R6254:Raly UTSW 2 154857366 missense probably damaging 1.00
R6887:Raly UTSW 2 154861910 missense probably damaging 0.99
R7069:Raly UTSW 2 154859744 missense possibly damaging 0.93
R7117:Raly UTSW 2 154857512 missense probably benign 0.35
R7289:Raly UTSW 2 154861854 missense probably damaging 1.00
R7311:Raly UTSW 2 154857420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGCTGATCCGATATGACTTTCAC -3'
(R):5'- TGATATGCACAGGCACAGGCTG -3'

Sequencing Primer
(F):5'- GGATCTTCAAATGACCCTCTCGG -3'
(R):5'- GCTGCATGTGAGGACTTTCC -3'
Posted On2013-05-09