Incidental Mutation 'R0227:Ceacam18'
ID33994
Institutional Source Beutler Lab
Gene Symbol Ceacam18
Ensembl Gene ENSMUSG00000030472
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 18
Synonyms2010110O04Rik
MMRRC Submission 038472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0227 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43634707-43649295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43639391 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 189 (G189C)
Ref Sequence ENSEMBL: ENSMUSP00000032663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032663]
Predicted Effect probably damaging
Transcript: ENSMUST00000032663
AA Change: G189C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032663
Gene: ENSMUSG00000030472
AA Change: G189C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG_like 36 135 1.03e2 SMART
IG_like 148 226 5.56e0 SMART
IGc2 248 305 5.24e-7 SMART
transmembrane domain 334 356 N/A INTRINSIC
Meta Mutation Damage Score 0.2241 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 86% (37/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,387,709 probably benign Het
Ankrd12 T A 17: 65,987,227 T404S probably benign Het
Ap4m1 T C 5: 138,176,276 probably benign Het
Atn1 A T 6: 124,746,930 probably benign Het
Bcl9l A G 9: 44,505,236 Y202C possibly damaging Het
Cfap65 C T 1: 74,931,958 W67* probably null Het
Col2a1 C T 15: 97,976,755 E1334K unknown Het
Crim1 A G 17: 78,344,509 probably benign Het
Csmd1 A G 8: 16,391,822 S343P probably benign Het
D430041D05Rik G T 2: 104,205,200 D1594E possibly damaging Het
Dgcr14 C T 16: 17,902,271 V406I probably damaging Het
Fam19a5 T C 15: 87,720,490 probably benign Het
Gcm2 C T 13: 41,105,856 V46M probably damaging Het
Gm3486 A T 14: 41,484,561 V185E probably benign Het
Gtf3a C A 5: 146,955,389 R317S probably damaging Het
Ice2 A G 9: 69,412,228 I320V probably benign Het
Jag1 A G 2: 137,115,618 V58A probably benign Het
Macf1 T C 4: 123,399,391 E1241G probably benign Het
Mogat2 T A 7: 99,223,132 I171F probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myo1c A T 11: 75,658,694 Y201F probably benign Het
Myo9b A G 8: 71,344,162 I884V probably damaging Het
Nudt9 T C 5: 104,061,675 I264T possibly damaging Het
Olfr948 A G 9: 39,318,678 V312A probably benign Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Rabgef1 T C 5: 130,190,990 V98A probably damaging Het
Raly A G 2: 154,865,921 D287G probably damaging Het
Raph1 A G 1: 60,525,977 V117A probably benign Het
Slc34a2 T C 5: 53,069,626 F697S possibly damaging Het
Son T A 16: 91,656,873 M836K probably damaging Het
Spock1 T C 13: 57,440,477 M258V possibly damaging Het
Stk10 G T 11: 32,617,859 C887F probably damaging Het
Synpo2 A G 3: 123,113,793 S625P probably benign Het
Synrg T A 11: 84,009,432 D821E probably damaging Het
Tg C A 15: 66,698,446 A1389E possibly damaging Het
Tspan33 G A 6: 29,713,478 V134M probably damaging Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Vmn1r210 C T 13: 22,827,391 V242I probably benign Het
Vmn1r63 C T 7: 5,802,742 W297* probably null Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zic5 A G 14: 122,459,661 I514T unknown Het
Other mutations in Ceacam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ceacam18 APN 7 43639356 missense probably benign 0.00
IGL00585:Ceacam18 APN 7 43637011 missense possibly damaging 0.90
IGL01669:Ceacam18 APN 7 43645515 missense probably damaging 1.00
R0001:Ceacam18 UTSW 7 43636876 missense possibly damaging 0.58
R1524:Ceacam18 UTSW 7 43639355 missense possibly damaging 0.95
R1647:Ceacam18 UTSW 7 43639265 missense possibly damaging 0.78
R1768:Ceacam18 UTSW 7 43648494 missense probably benign 0.00
R1828:Ceacam18 UTSW 7 43639456 missense probably benign 0.19
R3751:Ceacam18 UTSW 7 43641948 missense probably damaging 1.00
R4870:Ceacam18 UTSW 7 43641904 missense probably damaging 1.00
R5259:Ceacam18 UTSW 7 43637112 critical splice donor site probably null
R5358:Ceacam18 UTSW 7 43637073 missense possibly damaging 0.57
R5368:Ceacam18 UTSW 7 43642034 missense probably benign 0.08
R5810:Ceacam18 UTSW 7 43636958 missense probably benign 0.00
R5817:Ceacam18 UTSW 7 43641841 missense probably benign 0.07
R5835:Ceacam18 UTSW 7 43636958 missense probably benign 0.00
R7113:Ceacam18 UTSW 7 43641976 missense probably benign
R7138:Ceacam18 UTSW 7 43639282 missense possibly damaging 0.80
R7275:Ceacam18 UTSW 7 43641884 missense probably damaging 1.00
R7502:Ceacam18 UTSW 7 43636874 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTCAAAGCTTGAAGAAGCTGAC -3'
(R):5'- GGCTCAGCCATTTTCCTGGATACAC -3'

Sequencing Primer
(F):5'- GAAGCTGACACTATACCTGACTTG -3'
(R):5'- TTTTCCTGGATACACACAGACG -3'
Posted On2013-05-09