Incidental Mutation 'R0227:Bcl9l'
ID34000
Institutional Source Beutler Lab
Gene Symbol Bcl9l
Ensembl Gene ENSMUSG00000063382
Gene NameB cell CLL/lymphoma 9-like
SynonymsDLNB11
MMRRC Submission 038472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0227 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44482825-44511896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44505236 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 202 (Y202C)
Ref Sequence ENSEMBL: ENSMUSP00000151342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074989] [ENSMUST00000218183] [ENSMUST00000218913] [ENSMUST00000220303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074989
AA Change: Y239C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074516
Gene: ENSMUSG00000063382
AA Change: Y239C

DomainStartEndE-ValueType
low complexity region 215 234 N/A INTRINSIC
PDB:2XB1|C 236 269 2e-14 PDB
low complexity region 278 292 N/A INTRINSIC
low complexity region 297 325 N/A INTRINSIC
low complexity region 337 376 N/A INTRINSIC
Pfam:BCL9 395 432 2.4e-18 PFAM
low complexity region 490 507 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 590 602 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217898
Predicted Effect possibly damaging
Transcript: ENSMUST00000218183
AA Change: Y239C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000218913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220292
Predicted Effect possibly damaging
Transcript: ENSMUST00000220303
AA Change: Y202C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.5029 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 86% (37/43)
MGI Phenotype PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,387,709 probably benign Het
Ankrd12 T A 17: 65,987,227 T404S probably benign Het
Ap4m1 T C 5: 138,176,276 probably benign Het
Atn1 A T 6: 124,746,930 probably benign Het
Ceacam18 G T 7: 43,639,391 G189C probably damaging Het
Cfap65 C T 1: 74,931,958 W67* probably null Het
Col2a1 C T 15: 97,976,755 E1334K unknown Het
Crim1 A G 17: 78,344,509 probably benign Het
Csmd1 A G 8: 16,391,822 S343P probably benign Het
D430041D05Rik G T 2: 104,205,200 D1594E possibly damaging Het
Dgcr14 C T 16: 17,902,271 V406I probably damaging Het
Fam19a5 T C 15: 87,720,490 probably benign Het
Gcm2 C T 13: 41,105,856 V46M probably damaging Het
Gm3486 A T 14: 41,484,561 V185E probably benign Het
Gtf3a C A 5: 146,955,389 R317S probably damaging Het
Ice2 A G 9: 69,412,228 I320V probably benign Het
Jag1 A G 2: 137,115,618 V58A probably benign Het
Macf1 T C 4: 123,399,391 E1241G probably benign Het
Mogat2 T A 7: 99,223,132 I171F probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myo1c A T 11: 75,658,694 Y201F probably benign Het
Myo9b A G 8: 71,344,162 I884V probably damaging Het
Nudt9 T C 5: 104,061,675 I264T possibly damaging Het
Olfr948 A G 9: 39,318,678 V312A probably benign Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Rabgef1 T C 5: 130,190,990 V98A probably damaging Het
Raly A G 2: 154,865,921 D287G probably damaging Het
Raph1 A G 1: 60,525,977 V117A probably benign Het
Slc34a2 T C 5: 53,069,626 F697S possibly damaging Het
Son T A 16: 91,656,873 M836K probably damaging Het
Spock1 T C 13: 57,440,477 M258V possibly damaging Het
Stk10 G T 11: 32,617,859 C887F probably damaging Het
Synpo2 A G 3: 123,113,793 S625P probably benign Het
Synrg T A 11: 84,009,432 D821E probably damaging Het
Tg C A 15: 66,698,446 A1389E possibly damaging Het
Tspan33 G A 6: 29,713,478 V134M probably damaging Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Vmn1r210 C T 13: 22,827,391 V242I probably benign Het
Vmn1r63 C T 7: 5,802,742 W297* probably null Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zic5 A G 14: 122,459,661 I514T unknown Het
Other mutations in Bcl9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Bcl9l APN 9 44505627 missense possibly damaging 0.86
IGL00969:Bcl9l APN 9 44508242 missense possibly damaging 0.79
IGL01011:Bcl9l APN 9 44505179 missense possibly damaging 0.85
IGL01396:Bcl9l APN 9 44506824 missense probably damaging 0.99
IGL02015:Bcl9l APN 9 44508801 unclassified probably null
IGL02106:Bcl9l APN 9 44509199 missense probably benign 0.03
IGL02310:Bcl9l APN 9 44509305 missense probably damaging 1.00
IGL02447:Bcl9l APN 9 44507334 missense probably benign 0.09
IGL02534:Bcl9l APN 9 44505739 missense probably benign 0.00
IGL02541:Bcl9l APN 9 44507769 missense probably benign 0.02
IGL02688:Bcl9l APN 9 44505263 missense possibly damaging 0.86
IGL02931:Bcl9l APN 9 44500750 missense probably damaging 0.96
R0098:Bcl9l UTSW 9 44505617 missense probably benign
R0142:Bcl9l UTSW 9 44507112 missense probably benign 0.09
R0193:Bcl9l UTSW 9 44507406 missense probably damaging 1.00
R0481:Bcl9l UTSW 9 44506682 missense probably benign
R0496:Bcl9l UTSW 9 44509518 missense probably benign 0.00
R1741:Bcl9l UTSW 9 44509689 missense probably damaging 0.99
R1971:Bcl9l UTSW 9 44508699 unclassified probably null
R1976:Bcl9l UTSW 9 44506152 missense possibly damaging 0.76
R4415:Bcl9l UTSW 9 44501879 missense possibly damaging 0.83
R4751:Bcl9l UTSW 9 44506803 missense probably damaging 0.99
R4810:Bcl9l UTSW 9 44508353 missense probably damaging 1.00
R4880:Bcl9l UTSW 9 44508710 missense probably benign 0.01
R4967:Bcl9l UTSW 9 44505068 missense possibly damaging 0.85
R5418:Bcl9l UTSW 9 44505436 missense possibly damaging 0.53
R5572:Bcl9l UTSW 9 44500798 missense possibly damaging 0.66
R5658:Bcl9l UTSW 9 44509169 missense probably damaging 1.00
R5812:Bcl9l UTSW 9 44506644 missense probably benign 0.01
R6515:Bcl9l UTSW 9 44507874 splice site probably null
R6670:Bcl9l UTSW 9 44507072 small insertion probably benign
R6682:Bcl9l UTSW 9 44501103 missense possibly damaging 0.91
R6966:Bcl9l UTSW 9 44509388 nonsense probably null
R7171:Bcl9l UTSW 9 44505151 missense probably benign 0.33
R7338:Bcl9l UTSW 9 44508708 missense probably benign
R7448:Bcl9l UTSW 9 44509337 missense probably benign 0.00
R7609:Bcl9l UTSW 9 44505747 missense probably damaging 0.99
R7793:Bcl9l UTSW 9 44508966 missense probably benign 0.00
R7793:Bcl9l UTSW 9 44509697 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACAGATTGTAATGTAGCAGACCCAGC -3'
(R):5'- CACACTTACCTGATCCAGCTTGGC -3'

Sequencing Primer
(F):5'- TTGGGTCCTGGCCAAACT -3'
(R):5'- CTCTGCATAGGGAAGCAGC -3'
Posted On2013-05-09