Incidental Mutation 'R0227:Vmn2r92'
ID34014
Institutional Source Beutler Lab
Gene Symbol Vmn2r92
Ensembl Gene ENSMUSG00000091350
Gene Namevomeronasal 2, receptor 92
SynonymsEG627111
MMRRC Submission 038472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0227 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18151887-18188886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18167957 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 408 (A408V)
Ref Sequence ENSEMBL: ENSMUSP00000128685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169686]
Predicted Effect probably damaging
Transcript: ENSMUST00000169686
AA Change: A408V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128685
Gene: ENSMUSG00000091350
AA Change: A408V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 463 4.7e-38 PFAM
Pfam:NCD3G 510 564 2.5e-19 PFAM
Pfam:7tm_3 597 832 1.1e-52 PFAM
low complexity region 843 855 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 86% (37/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,387,709 probably benign Het
Ankrd12 T A 17: 65,987,227 T404S probably benign Het
Ap4m1 T C 5: 138,176,276 probably benign Het
Atn1 A T 6: 124,746,930 probably benign Het
Bcl9l A G 9: 44,505,236 Y202C possibly damaging Het
Ceacam18 G T 7: 43,639,391 G189C probably damaging Het
Cfap65 C T 1: 74,931,958 W67* probably null Het
Col2a1 C T 15: 97,976,755 E1334K unknown Het
Crim1 A G 17: 78,344,509 probably benign Het
Csmd1 A G 8: 16,391,822 S343P probably benign Het
D430041D05Rik G T 2: 104,205,200 D1594E possibly damaging Het
Dgcr14 C T 16: 17,902,271 V406I probably damaging Het
Fam19a5 T C 15: 87,720,490 probably benign Het
Gcm2 C T 13: 41,105,856 V46M probably damaging Het
Gm3486 A T 14: 41,484,561 V185E probably benign Het
Gtf3a C A 5: 146,955,389 R317S probably damaging Het
Ice2 A G 9: 69,412,228 I320V probably benign Het
Jag1 A G 2: 137,115,618 V58A probably benign Het
Macf1 T C 4: 123,399,391 E1241G probably benign Het
Mogat2 T A 7: 99,223,132 I171F probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myo1c A T 11: 75,658,694 Y201F probably benign Het
Myo9b A G 8: 71,344,162 I884V probably damaging Het
Nudt9 T C 5: 104,061,675 I264T possibly damaging Het
Olfr948 A G 9: 39,318,678 V312A probably benign Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Rabgef1 T C 5: 130,190,990 V98A probably damaging Het
Raly A G 2: 154,865,921 D287G probably damaging Het
Raph1 A G 1: 60,525,977 V117A probably benign Het
Slc34a2 T C 5: 53,069,626 F697S possibly damaging Het
Son T A 16: 91,656,873 M836K probably damaging Het
Spock1 T C 13: 57,440,477 M258V possibly damaging Het
Stk10 G T 11: 32,617,859 C887F probably damaging Het
Synpo2 A G 3: 123,113,793 S625P probably benign Het
Synrg T A 11: 84,009,432 D821E probably damaging Het
Tg C A 15: 66,698,446 A1389E possibly damaging Het
Tspan33 G A 6: 29,713,478 V134M probably damaging Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Vmn1r210 C T 13: 22,827,391 V242I probably benign Het
Vmn1r63 C T 7: 5,802,742 W297* probably null Het
Zic5 A G 14: 122,459,661 I514T unknown Het
Other mutations in Vmn2r92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Vmn2r92 APN 17 18185161 missense unknown
IGL01758:Vmn2r92 APN 17 18152013 nonsense probably null
IGL02614:Vmn2r92 APN 17 18167241 splice site probably benign
IGL03095:Vmn2r92 APN 17 18166710 missense possibly damaging 0.55
IGL03403:Vmn2r92 APN 17 18166852 missense probably damaging 0.98
R0133:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0225:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0265:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0266:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0267:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0420:Vmn2r92 UTSW 17 18168921 missense probably benign 0.01
R0426:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0494:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R1253:Vmn2r92 UTSW 17 18166766 missense probably benign 0.08
R1497:Vmn2r92 UTSW 17 18167363 missense probably benign 0.02
R1571:Vmn2r92 UTSW 17 18152090 missense probably damaging 0.96
R1656:Vmn2r92 UTSW 17 18151936 missense probably benign
R1816:Vmn2r92 UTSW 17 18166677 missense probably damaging 0.98
R2229:Vmn2r92 UTSW 17 18167392 missense probably benign 0.01
R2909:Vmn2r92 UTSW 17 18185115 missense possibly damaging 0.89
R3694:Vmn2r92 UTSW 17 18151943 nonsense probably null
R4207:Vmn2r92 UTSW 17 18184261 missense possibly damaging 0.62
R4548:Vmn2r92 UTSW 17 18171316 missense probably benign
R4612:Vmn2r92 UTSW 17 18166870 missense probably benign 0.25
R4742:Vmn2r92 UTSW 17 18166857 missense probably benign 0.06
R4824:Vmn2r92 UTSW 17 18151921 utr 5 prime probably benign
R4865:Vmn2r92 UTSW 17 18167372 missense probably benign 0.16
R4900:Vmn2r92 UTSW 17 18184343 missense probably benign 0.27
R5084:Vmn2r92 UTSW 17 18185177 makesense probably null
R5140:Vmn2r92 UTSW 17 18152050 missense probably benign 0.07
R5995:Vmn2r92 UTSW 17 18168951 critical splice donor site probably null
R6045:Vmn2r92 UTSW 17 18168043 critical splice donor site probably null
R6269:Vmn2r92 UTSW 17 18166774 missense probably benign 0.01
R6877:Vmn2r92 UTSW 17 18168822 missense probably damaging 1.00
R7151:Vmn2r92 UTSW 17 18166743 missense probably benign 0.01
R7260:Vmn2r92 UTSW 17 18166876 missense probably damaging 1.00
R7344:Vmn2r92 UTSW 17 18167251 missense probably benign 0.01
R7514:Vmn2r92 UTSW 17 18171271 missense probably damaging 1.00
R7576:Vmn2r92 UTSW 17 18167359 missense probably benign 0.01
R7584:Vmn2r92 UTSW 17 18166766 missense probably benign 0.08
X0066:Vmn2r92 UTSW 17 18184895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGGTATTTCTTCTTCAAGTGCTC -3'
(R):5'- GCTCCGGTGTTGAAAATGAGGGT -3'

Sequencing Primer
(F):5'- CTTCAAGTGCTCATTTGCTGG -3'
(R):5'- TGTACAGCTAGATACTGATGACAAG -3'
Posted On2013-05-09