Mutagenetix > Incidental Mutations

Incidental Mutation 'R0227:Crim1'

34016

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

038472-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0227 (G1)

Quality Score

221

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 78344509 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

Predicted Effect

probably benign
Transcript: ENSMUST00000112498

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.5%

Validation Efficiency

86% (37/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430038I01Rik	A	T	7: 137,387,709		probably benign	Het
Ankrd12	T	A	17: 65,987,227	T404S	probably benign	Het
Ap4m1	T	C	5: 138,176,276		probably benign	Het
Atn1	A	T	6: 124,746,930		probably benign	Het
Bcl9l	A	G	9: 44,505,236	Y202C	possibly damaging	Het
Ceacam18	G	T	7: 43,639,391	G189C	probably damaging	Het
Cfap65	C	T	1: 74,931,958	W67*	probably null	Het
Col2a1	C	T	15: 97,976,755	E1334K	unknown	Het
Csmd1	A	G	8: 16,391,822	S343P	probably benign	Het
D430041D05Rik	G	T	2: 104,205,200	D1594E	possibly damaging	Het
Dgcr14	C	T	16: 17,902,271	V406I	probably damaging	Het
Fam19a5	T	C	15: 87,720,490		probably benign	Het
Gcm2	C	T	13: 41,105,856	V46M	probably damaging	Het
Gm3486	A	T	14: 41,484,561	V185E	probably benign	Het
Gtf3a	C	A	5: 146,955,389	R317S	probably damaging	Het
Ice2	A	G	9: 69,412,228	I320V	probably benign	Het
Jag1	A	G	2: 137,115,618	V58A	probably benign	Het
Macf1	T	C	4: 123,399,391	E1241G	probably benign	Het
Mogat2	T	A	7: 99,223,132	I171F	probably benign	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myo1c	A	T	11: 75,658,694	Y201F	probably benign	Het
Myo9b	A	G	8: 71,344,162	I884V	probably damaging	Het
Nudt9	T	C	5: 104,061,675	I264T	possibly damaging	Het
Olfr948	A	G	9: 39,318,678	V312A	probably benign	Het
Pdcd11	AGAGGAGGAGGAGGAGGAGGAGGAG	AGAGGAGGAGGAGGAGGAGGAG	19: 47,113,437		probably benign	Het
Rabgef1	T	C	5: 130,190,990	V98A	probably damaging	Het
Raly	A	G	2: 154,865,921	D287G	probably damaging	Het
Raph1	A	G	1: 60,525,977	V117A	probably benign	Het
Slc34a2	T	C	5: 53,069,626	F697S	possibly damaging	Het
Son	T	A	16: 91,656,873	M836K	probably damaging	Het
Spock1	T	C	13: 57,440,477	M258V	possibly damaging	Het
Stk10	G	T	11: 32,617,859	C887F	probably damaging	Het
Synpo2	A	G	3: 123,113,793	S625P	probably benign	Het
Synrg	T	A	11: 84,009,432	D821E	probably damaging	Het
Tg	C	A	15: 66,698,446	A1389E	possibly damaging	Het
Tspan33	G	A	6: 29,713,478	V134M	probably damaging	Het
Ubr4	T	C	4: 139,431,649	F2438L	probably benign	Het
Vmn1r210	C	T	13: 22,827,391	V242I	probably benign	Het
Vmn1r63	C	T	7: 5,802,742	W297*	probably null	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Zic5	A	G	14: 122,459,661	I514T	unknown	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- AACATGGCGTCTGTGTGTCTCC -3'
(R):5'- CATCGAGCCTTGTTTCCAGCCTTAG -3'

Sequencing Primer
(F):5'- TGTCTCCACAGGGGAGGAAC -3'
(R):5'- ACAGACATGACCACGTTAGC -3'

Posted On

2013-05-09