Incidental Mutation 'R0230:Scn7a'
ID 34027
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission 038473-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R0230 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66556628 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 319 (E319G)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: E319G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: E319G

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Meta Mutation Damage Score 0.7828 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amy1 T C 3: 113,352,079 (GRCm39) D371G probably benign Het
Asrgl1 T A 19: 9,095,883 (GRCm39) probably benign Het
Asxl3 T A 18: 22,585,383 (GRCm39) probably benign Het
B3galnt1 T C 3: 69,482,673 (GRCm39) N196S possibly damaging Het
Bbof1 A G 12: 84,471,978 (GRCm39) H74R probably damaging Het
Bpifb9b C T 2: 154,158,995 (GRCm39) T504M probably damaging Het
Cdk12 T G 11: 98,094,817 (GRCm39) S208R probably damaging Het
Cdk5r1 T C 11: 80,368,576 (GRCm39) L81P probably damaging Het
Chrd T C 16: 20,552,025 (GRCm39) L43P probably benign Het
Col6a4 A C 9: 105,949,565 (GRCm39) M690R probably benign Het
Cyp39a1 A T 17: 44,042,903 (GRCm39) R418W probably damaging Het
Dars2 C T 1: 160,890,357 (GRCm39) V162M probably benign Het
Dixdc1 C T 9: 50,606,807 (GRCm39) V270M possibly damaging Het
Dnah11 C A 12: 117,946,791 (GRCm39) E1194* probably null Het
Dnah7b T C 1: 46,258,508 (GRCm39) S1900P probably damaging Het
Dnah9 C T 11: 65,746,141 (GRCm39) E3991K probably damaging Het
Dsp A T 13: 38,381,681 (GRCm39) I2210F probably benign Het
Ebf1 A G 11: 44,886,949 (GRCm39) S556G probably damaging Het
Enam G A 5: 88,637,514 (GRCm39) probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Epc1 T C 18: 6,440,168 (GRCm39) D579G probably damaging Het
Ephb3 A T 16: 21,039,525 (GRCm39) I426F probably damaging Het
Fam135b T G 15: 71,317,886 (GRCm39) I1359L probably benign Het
Fcgbpl1 T A 7: 27,856,250 (GRCm39) H2012Q probably damaging Het
Gm16519 T C 17: 71,236,128 (GRCm39) S26P probably benign Het
Gm17622 T A 13: 96,627,594 (GRCm39) probably null Het
Gpat2 G A 2: 127,277,765 (GRCm39) V764I possibly damaging Het
Gpx4 G A 10: 79,890,838 (GRCm39) A81T probably benign Het
Gss C A 2: 155,420,326 (GRCm39) R83L probably damaging Het
Hcls1 C A 16: 36,758,216 (GRCm39) Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 (GRCm39) V438A probably benign Het
Hnf4a T C 2: 163,401,005 (GRCm39) F184S probably damaging Het
Katnal1 T A 5: 148,855,460 (GRCm39) D90V possibly damaging Het
Kcnt2 A G 1: 140,174,083 (GRCm39) D30G probably benign Het
Kyat1 T C 2: 30,084,087 (GRCm39) E11G probably benign Het
Lefty1 T A 1: 180,764,579 (GRCm39) V168E probably damaging Het
Map2k6 C T 11: 110,387,281 (GRCm39) P218S probably damaging Het
Mlkl C G 8: 112,041,694 (GRCm39) K415N probably benign Het
Myh7 A T 14: 55,211,390 (GRCm39) M1593K probably benign Het
Myo19 T A 11: 84,784,159 (GRCm39) C186S possibly damaging Het
Ngp T C 9: 110,249,069 (GRCm39) L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 (GRCm38) N192S probably benign Het
Or1j17 G A 2: 36,578,628 (GRCm39) V205M probably benign Het
Or2n1 A G 17: 38,486,841 (GRCm39) I289V probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or8u9 T C 2: 86,001,886 (GRCm39) I92V probably benign Het
Pdcd6ip A G 9: 113,514,361 (GRCm39) probably benign Het
Pde4b T C 4: 102,454,707 (GRCm39) Y186H probably benign Het
Pex7 A G 10: 19,780,331 (GRCm39) V101A possibly damaging Het
Phldb3 G A 7: 24,312,004 (GRCm39) R106Q probably benign Het
Plxnc1 A G 10: 94,635,209 (GRCm39) V1339A probably benign Het
Proser1 A G 3: 53,386,383 (GRCm39) N755S probably damaging Het
Ptpn13 A G 5: 103,674,997 (GRCm39) D658G probably damaging Het
Rassf8 A C 6: 145,765,700 (GRCm39) probably benign Het
Rfc4 G A 16: 22,932,849 (GRCm39) Q363* probably null Het
Rxfp1 T C 3: 79,552,282 (GRCm39) N673S probably damaging Het
Scnn1g A G 7: 121,345,984 (GRCm39) probably benign Het
Scube2 C T 7: 109,423,971 (GRCm39) probably null Het
Slc4a4 A C 5: 89,304,195 (GRCm39) H502P possibly damaging Het
Slc6a13 A G 6: 121,301,262 (GRCm39) N184D probably benign Het
Slco1a5 T A 6: 142,182,054 (GRCm39) probably benign Het
Slf1 T A 13: 77,260,867 (GRCm39) probably benign Het
Smarca4 G A 9: 21,612,168 (GRCm39) V1518I probably damaging Het
Smyd3 A G 1: 179,250,993 (GRCm39) probably benign Het
Sox5 A G 6: 144,155,064 (GRCm39) F11L probably benign Het
Spag17 T C 3: 100,014,143 (GRCm39) S2139P probably benign Het
Spice1 A T 16: 44,185,939 (GRCm39) probably benign Het
Sptan1 T A 2: 29,900,704 (GRCm39) probably benign Het
Srebf2 T A 15: 82,066,286 (GRCm39) N571K probably damaging Het
Tbl3 A G 17: 24,920,307 (GRCm39) L670P probably damaging Het
Tmem45a2 A G 16: 56,867,359 (GRCm39) V114A possibly damaging Het
Tmigd3 A G 3: 105,826,053 (GRCm39) N132D possibly damaging Het
Ttn T C 2: 76,567,778 (GRCm39) D19378G probably damaging Het
Ugcg C A 4: 59,189,739 (GRCm39) Y32* probably null Het
Ush2a C T 1: 188,582,301 (GRCm39) P3788L probably damaging Het
Usp22 T A 11: 61,050,023 (GRCm39) probably benign Het
Xaf1 T C 11: 72,197,381 (GRCm39) probably benign Het
Zbtb41 C T 1: 139,374,673 (GRCm39) T711I probably damaging Het
Zfp457 T C 13: 67,442,180 (GRCm39) T132A possibly damaging Het
Zfp64 T G 2: 168,754,150 (GRCm39) probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAAGCTACCTTTATCGTGTGCAG -3'
(R):5'- CGGCAAACAGATTACCGCTGAGATAC -3'

Sequencing Primer
(F):5'- ATCGTGTGCAGTTCATACTATCTC -3'
(R):5'- cacggtgattgtagatatgtgag -3'
Posted On 2013-05-09