Incidental Mutation 'R0230:Gss'
ID34032
Institutional Source Beutler Lab
Gene Symbol Gss
Ensembl Gene ENSMUSG00000027610
Gene Nameglutathione synthetase
SynonymsGS-A/GS-B
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0230 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155563181-155592810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 155578406 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 83 (R83L)
Ref Sequence ENSEMBL: ENSMUSP00000117266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000126322] [ENSMUST00000130881] [ENSMUST00000155347]
Predicted Effect probably benign
Transcript: ENSMUST00000065973
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079691
AA Change: R125L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610
AA Change: R125L

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 12 472 6.7e-131 PFAM
Pfam:GSH_synthase 204 302 2.5e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126322
AA Change: R83L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117266
Gene: ENSMUSG00000027610
AA Change: R83L

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 197 1.2e-63 PFAM
Pfam:GSH_synthase 160 200 3.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130881
AA Change: R56L

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610
AA Change: R56L

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 404 9.2e-130 PFAM
Pfam:GSH_synthase 133 233 9e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153975
Predicted Effect probably damaging
Transcript: ENSMUST00000155347
AA Change: R125L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122662
Gene: ENSMUSG00000027610
AA Change: R125L

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 5 179 1.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176415
Meta Mutation Damage Score 0.9352 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation all die before E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Cdk5r1 T C 11: 80,477,750 L81P probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Cyp39a1 A T 17: 43,732,012 R418W probably damaging Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Ephb3 A T 16: 21,220,775 I426F probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Map2k6 C T 11: 110,496,455 P218S probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Rxfp1 T C 3: 79,644,975 N673S probably damaging Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smarca4 G A 9: 21,700,872 V1518I probably damaging Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Xaf1 T C 11: 72,306,555 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp457 T C 13: 67,294,116 T132A possibly damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Gss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Gss APN 2 155581951 missense probably damaging 1.00
IGL01737:Gss APN 2 155567806 missense probably damaging 1.00
IGL01783:Gss APN 2 155571559 missense probably damaging 1.00
IGL02329:Gss APN 2 155567853 missense probably benign 0.01
IGL02386:Gss APN 2 155573170 missense probably benign 0.01
IGL02948:Gss APN 2 155577621 missense probably damaging 1.00
PIT4515001:Gss UTSW 2 155578341 missense probably damaging 1.00
R0446:Gss UTSW 2 155567745 missense probably benign 0.00
R0931:Gss UTSW 2 155567689 intron probably benign
R1396:Gss UTSW 2 155567721 missense probably damaging 0.99
R2896:Gss UTSW 2 155564829 missense probably damaging 1.00
R2986:Gss UTSW 2 155587443 missense probably benign 0.21
R4852:Gss UTSW 2 155564865 missense probably benign 0.06
R5148:Gss UTSW 2 155573109 missense possibly damaging 0.80
R6017:Gss UTSW 2 155587465 missense probably benign
R6574:Gss UTSW 2 155582011 missense probably damaging 1.00
R6868:Gss UTSW 2 155567812 missense possibly damaging 0.69
R8274:Gss UTSW 2 155587504 missense probably benign 0.00
R8510:Gss UTSW 2 155567824 nonsense probably null
R8801:Gss UTSW 2 155564766 missense probably damaging 1.00
R8903:Gss UTSW 2 155578359 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAGTGACTATTGGTCCATTGAGC -3'
(R):5'- GACGACTATACTGCCCGTCTCTTTG -3'

Sequencing Primer
(F):5'- AGCTCTTCCCCACAAATGAG -3'
(R):5'- TAGGAATCTGCCTCTGACCAG -3'
Posted On2013-05-09