Incidental Mutation 'R0230:Rxfp1'
ID34037
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Namerelaxin/insulin-like family peptide receptor 1
SynonymsLgr7, LOC381489
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R0230 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79641611-79737880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79644975 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 673 (N673S)
Ref Sequence ENSEMBL: ENSMUSP00000077611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
Predicted Effect probably damaging
Transcript: ENSMUST00000078527
AA Change: N673S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: N673S

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182491
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Meta Mutation Damage Score 0.6755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Cdk5r1 T C 11: 80,477,750 L81P probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Cyp39a1 A T 17: 43,732,012 R418W probably damaging Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Ephb3 A T 16: 21,220,775 I426F probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Gss C A 2: 155,578,406 R83L probably damaging Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Map2k6 C T 11: 110,496,455 P218S probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smarca4 G A 9: 21,700,872 V1518I probably damaging Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Xaf1 T C 11: 72,306,555 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp457 T C 13: 67,294,116 T132A possibly damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79652216 missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79686868 missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79660078 missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79660096 missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79650492 missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79660120 missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79652167 critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79670846 critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79652226 missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79667683 missense probably benign 0.29
juggler UTSW 3 79650591 nonsense probably null
R0123:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0134:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0257:Rxfp1 UTSW 3 79682535 missense possibly damaging 0.61
R0265:Rxfp1 UTSW 3 79667654 missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79737793 start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79652377 missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79650731 missense probably benign 0.00
R0547:Rxfp1 UTSW 3 79705569 splice site probably null
R0627:Rxfp1 UTSW 3 79648211 missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79663293 splice site probably null
R1309:Rxfp1 UTSW 3 79663292 splice site probably null
R1756:Rxfp1 UTSW 3 79670881 missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79737769 missense probably benign
R2415:Rxfp1 UTSW 3 79663319 missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79682471 missense possibly damaging 0.80
R4087:Rxfp1 UTSW 3 79644949 missense probably damaging 0.99
R4091:Rxfp1 UTSW 3 79644761 missense probably benign
R4250:Rxfp1 UTSW 3 79652272 missense probably benign 0.41
R4335:Rxfp1 UTSW 3 79686798 critical splice donor site probably null
R4447:Rxfp1 UTSW 3 79652127 intron probably benign
R4607:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79705668 missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79686868 missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79650582 missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79644802 missense probably benign
R5059:Rxfp1 UTSW 3 79663312 missense probably benign
R5131:Rxfp1 UTSW 3 79652164 splice site probably null
R5641:Rxfp1 UTSW 3 79686892 missense probably damaging 0.98
R5711:Rxfp1 UTSW 3 79678747 missense probably damaging 1.00
R5757:Rxfp1 UTSW 3 79661320 missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79663313 missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79667848 missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79648289 missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79650591 nonsense probably null
R7059:Rxfp1 UTSW 3 79652269 missense probably damaging 1.00
R7530:Rxfp1 UTSW 3 79650461 missense probably benign 0.18
R7626:Rxfp1 UTSW 3 79648090 missense probably damaging 0.99
R7684:Rxfp1 UTSW 3 79670907 missense possibly damaging 0.66
R7951:Rxfp1 UTSW 3 79652375 missense probably damaging 1.00
Z1088:Rxfp1 UTSW 3 79705704 missense probably damaging 1.00
Z1177:Rxfp1 UTSW 3 79652367 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAACCCAGAGGACATCTCCTGC -3'
(R):5'- AAAGCCTCCAGAGCACTGGCATTC -3'

Sequencing Primer
(F):5'- CTGCAAGGGCCACATTTC -3'
(R):5'- GAGCACTGGCATTCCTTTAAAC -3'
Posted On2013-05-09