Mutagenetix > Incidental Mutations

Incidental Mutation 'R0230:Enam'

34043

Institutional Source

Beutler Lab

Gene Symbol

Enam

Ensembl Gene

ENSMUSG00000029286

Gene Name

enamelin

Synonyms

abte

MMRRC Submission

038473-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.327) question?

Stock #

R0230 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88487975-88506049 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 88489655 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]

Predicted Effect

probably benign
Transcript: ENSMUST00000031222

SMART Domains

Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
low complexity region	67	114	N/A	INTRINSIC
low complexity region	128	150	N/A	INTRINSIC
low complexity region	159	167	N/A	INTRINSIC
low complexity region	173	187	N/A	INTRINSIC
low complexity region	203	214	N/A	INTRINSIC
Pfam:Enamelin	216	441	5.4e-74	PFAM
Pfam:Enamelin	503	1249	1.9e-303	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199104

SMART Domains

Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286

Domain	Start	End	E-Value	Type
low complexity region	100	113	N/A	INTRINSIC
low complexity region	142	189	N/A	INTRINSIC
low complexity region	203	225	N/A	INTRINSIC
low complexity region	234	242	N/A	INTRINSIC
low complexity region	248	262	N/A	INTRINSIC
low complexity region	278	289	N/A	INTRINSIC
Pfam:Enamelin	291	510	2.5e-74	PFAM
Pfam:Enamelin	550	1325	N/A	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.7%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,156,825	H2012Q	probably damaging	Het
Amy1	T	C	3: 113,558,430	D371G	probably benign	Het
Asrgl1	T	A	19: 9,118,519		probably benign	Het
Asxl3	T	A	18: 22,452,326		probably benign	Het
B3galnt1	T	C	3: 69,575,340	N196S	possibly damaging	Het
Bbof1	A	G	12: 84,425,204	H74R	probably damaging	Het
Bpifb9b	C	T	2: 154,317,075	T504M	probably damaging	Het
Cdk12	T	G	11: 98,203,991	S208R	probably damaging	Het
Cdk5r1	T	C	11: 80,477,750	L81P	probably damaging	Het
Chrd	T	C	16: 20,733,275	L43P	probably benign	Het
Col6a4	A	C	9: 106,072,366	M690R	probably benign	Het
Cyp39a1	A	T	17: 43,732,012	R418W	probably damaging	Het
Dars2	C	T	1: 161,062,787	V162M	probably benign	Het
Dixdc1	C	T	9: 50,695,507	V270M	possibly damaging	Het
Dnah11	C	A	12: 117,983,056	E1194*	probably null	Het
Dnah7b	T	C	1: 46,219,348	S1900P	probably damaging	Het
Dnah9	C	T	11: 65,855,315	E3991K	probably damaging	Het
Dsp	A	T	13: 38,197,705	I2210F	probably benign	Het
Ebf1	A	G	11: 44,996,122	S556G	probably damaging	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Epc1	T	C	18: 6,440,168	D579G	probably damaging	Het
Ephb3	A	T	16: 21,220,775	I426F	probably damaging	Het
Fam135b	T	G	15: 71,446,037	I1359L	probably benign	Het
Gm16519	T	C	17: 70,929,133	S26P	probably benign	Het
Gm17622	T	A	13: 96,491,086		probably null	Het
Gpat2	G	A	2: 127,435,845	V764I	possibly damaging	Het
Gpx4	G	A	10: 80,055,004	A81T	probably benign	Het
Gss	C	A	2: 155,578,406	R83L	probably damaging	Het
Hcls1	C	A	16: 36,937,854	Q36K	probably damaging	Het
Hepacam2	A	G	6: 3,463,336	V438A	probably benign	Het
Hnf4a	T	C	2: 163,559,085	F184S	probably damaging	Het
Katnal1	T	A	5: 148,918,650	D90V	possibly damaging	Het
Kcnt2	A	G	1: 140,246,345	D30G	probably benign	Het
Kyat1	T	C	2: 30,194,075	E11G	probably benign	Het
Lefty1	T	A	1: 180,937,014	V168E	probably damaging	Het
Map2k6	C	T	11: 110,496,455	P218S	probably damaging	Het
Mlkl	C	G	8: 111,315,062	K415N	probably benign	Het
Myh7	A	T	14: 54,973,933	M1593K	probably benign	Het
Myo19	T	A	11: 84,893,333	C186S	possibly damaging	Het
Ngp	T	C	9: 110,420,001	L47P	probably damaging	Het
Nkiras1	A	G	14: 18,280,185	N192S	probably benign	Het
Olfr1044	T	C	2: 86,171,542	I92V	probably benign	Het
Olfr134	A	G	17: 38,175,950	I289V	probably damaging	Het
Olfr346	G	A	2: 36,688,616	V205M	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pdcd6ip	A	G	9: 113,685,293		probably benign	Het
Pde4b	T	C	4: 102,597,510	Y186H	probably benign	Het
Pex7	A	G	10: 19,904,585	V101A	possibly damaging	Het
Phldb3	G	A	7: 24,612,579	R106Q	probably benign	Het
Plxnc1	A	G	10: 94,799,347	V1339A	probably benign	Het
Proser1	A	G	3: 53,478,962	N755S	probably damaging	Het
Ptpn13	A	G	5: 103,527,131	D658G	probably damaging	Het
Rassf8	A	C	6: 145,819,974		probably benign	Het
Rfc4	G	A	16: 23,114,099	Q363*	probably null	Het
Rxfp1	T	C	3: 79,644,975	N673S	probably damaging	Het
Scn7a	T	C	2: 66,726,284	E319G	probably damaging	Het
Scnn1g	A	G	7: 121,746,761		probably benign	Het
Scube2	C	T	7: 109,824,764		probably null	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slc6a13	A	G	6: 121,324,303	N184D	probably benign	Het
Slco1a5	T	A	6: 142,236,328		probably benign	Het
Slf1	T	A	13: 77,112,748		probably benign	Het
Smarca4	G	A	9: 21,700,872	V1518I	probably damaging	Het
Smyd3	A	G	1: 179,423,428		probably benign	Het
Sox5	A	G	6: 144,209,338	F11L	probably benign	Het
Spag17	T	C	3: 100,106,827	S2139P	probably benign	Het
Spice1	A	T	16: 44,365,576		probably benign	Het
Sptan1	T	A	2: 30,010,692		probably benign	Het
Srebf2	T	A	15: 82,182,085	N571K	probably damaging	Het
Tbl3	A	G	17: 24,701,333	L670P	probably damaging	Het
Tmem45a2	A	G	16: 57,046,996	V114A	possibly damaging	Het
Tmigd3	A	G	3: 105,918,737	N132D	possibly damaging	Het
Ttn	T	C	2: 76,737,434	D19378G	probably damaging	Het
Ugcg	C	A	4: 59,189,739	Y32*	probably null	Het
Ush2a	C	T	1: 188,850,104	P3788L	probably damaging	Het
Usp22	T	A	11: 61,159,197		probably benign	Het
Xaf1	T	C	11: 72,306,555		probably benign	Het
Zbtb41	C	T	1: 139,446,935	T711I	probably damaging	Het
Zfp457	T	C	13: 67,294,116	T132A	possibly damaging	Het
Zfp64	T	G	2: 168,912,230		probably benign	Het

Other mutations in Enam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Enam	APN	5	88501484	missense	possibly damaging	0.83
IGL01611:Enam	APN	5	88503749	missense	probably damaging	0.99
IGL01802:Enam	APN	5	88503674	missense	possibly damaging	0.93
IGL02220:Enam	APN	5	88504559	nonsense	probably null
IGL02371:Enam	APN	5	88502809	missense	probably benign	0.39
IGL02596:Enam	APN	5	88503026	missense	probably benign	0.01
IGL03026:Enam	APN	5	88503299	missense	probably benign	0.38
IGL03303:Enam	APN	5	88504591	missense	probably benign	0.12
opinionated	UTSW	5	88503026	missense	probably benign	0.04
recalcitrant	UTSW	5	88503791	nonsense	probably null
R0200:Enam	UTSW	5	88493027	missense	possibly damaging	0.96
R0395:Enam	UTSW	5	88501508	missense	probably damaging	0.99
R0548:Enam	UTSW	5	88503105	missense	probably damaging	0.96
R0608:Enam	UTSW	5	88493027	missense	possibly damaging	0.96
R0724:Enam	UTSW	5	88501994	missense	probably damaging	1.00
R0927:Enam	UTSW	5	88494060	missense	possibly damaging	0.72
R1023:Enam	UTSW	5	88501967	missense	probably damaging	0.99
R1053:Enam	UTSW	5	88504019	missense	possibly damaging	0.64
R1169:Enam	UTSW	5	88503258	missense	probably damaging	1.00
R1230:Enam	UTSW	5	88494068	missense	probably damaging	0.99
R1324:Enam	UTSW	5	88494068	missense	possibly damaging	0.53
R1663:Enam	UTSW	5	88503994	missense	probably damaging	1.00
R1727:Enam	UTSW	5	88503994	missense	probably damaging	1.00
R1750:Enam	UTSW	5	88503227	missense	probably damaging	1.00
R1852:Enam	UTSW	5	88504465	missense	possibly damaging	0.92
R1907:Enam	UTSW	5	88504622	missense	possibly damaging	0.86
R2104:Enam	UTSW	5	88501787	missense	probably damaging	1.00
R2143:Enam	UTSW	5	88492920	missense	probably benign	0.02
R2196:Enam	UTSW	5	88502744	missense	probably damaging	0.99
R2363:Enam	UTSW	5	88503149	missense	probably benign	0.24
R2497:Enam	UTSW	5	88502694	missense	probably benign	0.13
R3615:Enam	UTSW	5	88504447	missense	possibly damaging	0.81
R3616:Enam	UTSW	5	88504447	missense	possibly damaging	0.81
R3782:Enam	UTSW	5	88502815	missense	probably damaging	1.00
R4067:Enam	UTSW	5	88503377	missense	probably damaging	1.00
R4349:Enam	UTSW	5	88503548	missense	probably damaging	0.99
R4604:Enam	UTSW	5	88504283	missense	possibly damaging	0.93
R4649:Enam	UTSW	5	88492968	missense	probably benign	0.02
R4702:Enam	UTSW	5	88503791	nonsense	probably null
R4703:Enam	UTSW	5	88503791	nonsense	probably null
R4704:Enam	UTSW	5	88503791	nonsense	probably null
R4705:Enam	UTSW	5	88503791	nonsense	probably null
R4714:Enam	UTSW	5	88503536	missense	probably damaging	1.00
R4748:Enam	UTSW	5	88501543	missense	probably damaging	1.00
R4838:Enam	UTSW	5	88493108	nonsense	probably null
R4840:Enam	UTSW	5	88503026	missense	probably benign	0.04
R4856:Enam	UTSW	5	88488734	nonsense	probably null
R4886:Enam	UTSW	5	88488734	nonsense	probably null
R4910:Enam	UTSW	5	88502314	missense	probably benign
R4911:Enam	UTSW	5	88502314	missense	probably benign
R6103:Enam	UTSW	5	88502328	missense	probably damaging	0.96
R6651:Enam	UTSW	5	88502917	missense	probably damaging	0.98
R6759:Enam	UTSW	5	88501691	missense	probably damaging	1.00
R7282:Enam	UTSW	5	88502327	missense	probably damaging	0.99
R7365:Enam	UTSW	5	88501488	missense	possibly damaging	0.75
R7392:Enam	UTSW	5	88501664	missense	probably damaging	0.99
R7483:Enam	UTSW	5	88501820	missense	probably damaging	1.00
R7647:Enam	UTSW	5	88503025	missense	probably benign	0.00
R7648:Enam	UTSW	5	88504157	missense	possibly damaging	0.89
R7672:Enam	UTSW	5	88503971	missense	possibly damaging	0.80
R7943:Enam	UTSW	5	88488551	splice site	probably null
R7999:Enam	UTSW	5	88503702	missense	probably benign
R8117:Enam	UTSW	5	88503526	missense	probably benign	0.00
R8419:Enam	UTSW	5	88503350	missense	possibly damaging	0.80
R8528:Enam	UTSW	5	88502219	missense	probably damaging	0.98
X0018:Enam	UTSW	5	88502691	nonsense	probably null
Z1176:Enam	UTSW	5	88492971	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGCCTTGATCCACGACCTGAGAG -3'
(R):5'- GAATAAAGCTGGCCCCAGAGCTAAC -3'

Sequencing Primer
(F):5'- GTTGAGAAAGGAGATCCTCTACCTAC -3'
(R):5'- TGAAACACATAGCAGGCTCG -3'

Posted On

2013-05-09