Incidental Mutation 'R0230:Slc6a13'
ID 34048
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gabt3, Gat2
MMRRC Submission 038473-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.729) question?
Stock # R0230 (G1)
Quality Score 187
Status Validated
Chromosome 6
Chromosomal Location 121277247-121314680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121301262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 184 (N184D)
Ref Sequence ENSEMBL: ENSMUSP00000120689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580] [ENSMUST00000142419]
AlphaFold P31649
Predicted Effect probably benign
Transcript: ENSMUST00000064580
AA Change: N173D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: N173D

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142021
Predicted Effect probably benign
Transcript: ENSMUST00000142419
AA Change: N184D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120689
Gene: ENSMUSG00000030108
AA Change: N184D

DomainStartEndE-ValueType
Pfam:SNF 43 192 4e-78 PFAM
Meta Mutation Damage Score 0.1149 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amy1 T C 3: 113,352,079 (GRCm39) D371G probably benign Het
Asrgl1 T A 19: 9,095,883 (GRCm39) probably benign Het
Asxl3 T A 18: 22,585,383 (GRCm39) probably benign Het
B3galnt1 T C 3: 69,482,673 (GRCm39) N196S possibly damaging Het
Bbof1 A G 12: 84,471,978 (GRCm39) H74R probably damaging Het
Bpifb9b C T 2: 154,158,995 (GRCm39) T504M probably damaging Het
Cdk12 T G 11: 98,094,817 (GRCm39) S208R probably damaging Het
Cdk5r1 T C 11: 80,368,576 (GRCm39) L81P probably damaging Het
Chrd T C 16: 20,552,025 (GRCm39) L43P probably benign Het
Col6a4 A C 9: 105,949,565 (GRCm39) M690R probably benign Het
Cyp39a1 A T 17: 44,042,903 (GRCm39) R418W probably damaging Het
Dars2 C T 1: 160,890,357 (GRCm39) V162M probably benign Het
Dixdc1 C T 9: 50,606,807 (GRCm39) V270M possibly damaging Het
Dnah11 C A 12: 117,946,791 (GRCm39) E1194* probably null Het
Dnah7b T C 1: 46,258,508 (GRCm39) S1900P probably damaging Het
Dnah9 C T 11: 65,746,141 (GRCm39) E3991K probably damaging Het
Dsp A T 13: 38,381,681 (GRCm39) I2210F probably benign Het
Ebf1 A G 11: 44,886,949 (GRCm39) S556G probably damaging Het
Enam G A 5: 88,637,514 (GRCm39) probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Epc1 T C 18: 6,440,168 (GRCm39) D579G probably damaging Het
Ephb3 A T 16: 21,039,525 (GRCm39) I426F probably damaging Het
Fam135b T G 15: 71,317,886 (GRCm39) I1359L probably benign Het
Fcgbpl1 T A 7: 27,856,250 (GRCm39) H2012Q probably damaging Het
Gm16519 T C 17: 71,236,128 (GRCm39) S26P probably benign Het
Gm17622 T A 13: 96,627,594 (GRCm39) probably null Het
Gpat2 G A 2: 127,277,765 (GRCm39) V764I possibly damaging Het
Gpx4 G A 10: 79,890,838 (GRCm39) A81T probably benign Het
Gss C A 2: 155,420,326 (GRCm39) R83L probably damaging Het
Hcls1 C A 16: 36,758,216 (GRCm39) Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 (GRCm39) V438A probably benign Het
Hnf4a T C 2: 163,401,005 (GRCm39) F184S probably damaging Het
Katnal1 T A 5: 148,855,460 (GRCm39) D90V possibly damaging Het
Kcnt2 A G 1: 140,174,083 (GRCm39) D30G probably benign Het
Kyat1 T C 2: 30,084,087 (GRCm39) E11G probably benign Het
Lefty1 T A 1: 180,764,579 (GRCm39) V168E probably damaging Het
Map2k6 C T 11: 110,387,281 (GRCm39) P218S probably damaging Het
Mlkl C G 8: 112,041,694 (GRCm39) K415N probably benign Het
Myh7 A T 14: 55,211,390 (GRCm39) M1593K probably benign Het
Myo19 T A 11: 84,784,159 (GRCm39) C186S possibly damaging Het
Ngp T C 9: 110,249,069 (GRCm39) L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 (GRCm38) N192S probably benign Het
Or1j17 G A 2: 36,578,628 (GRCm39) V205M probably benign Het
Or2n1 A G 17: 38,486,841 (GRCm39) I289V probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or8u9 T C 2: 86,001,886 (GRCm39) I92V probably benign Het
Pdcd6ip A G 9: 113,514,361 (GRCm39) probably benign Het
Pde4b T C 4: 102,454,707 (GRCm39) Y186H probably benign Het
Pex7 A G 10: 19,780,331 (GRCm39) V101A possibly damaging Het
Phldb3 G A 7: 24,312,004 (GRCm39) R106Q probably benign Het
Plxnc1 A G 10: 94,635,209 (GRCm39) V1339A probably benign Het
Proser1 A G 3: 53,386,383 (GRCm39) N755S probably damaging Het
Ptpn13 A G 5: 103,674,997 (GRCm39) D658G probably damaging Het
Rassf8 A C 6: 145,765,700 (GRCm39) probably benign Het
Rfc4 G A 16: 22,932,849 (GRCm39) Q363* probably null Het
Rxfp1 T C 3: 79,552,282 (GRCm39) N673S probably damaging Het
Scn7a T C 2: 66,556,628 (GRCm39) E319G probably damaging Het
Scnn1g A G 7: 121,345,984 (GRCm39) probably benign Het
Scube2 C T 7: 109,423,971 (GRCm39) probably null Het
Slc4a4 A C 5: 89,304,195 (GRCm39) H502P possibly damaging Het
Slco1a5 T A 6: 142,182,054 (GRCm39) probably benign Het
Slf1 T A 13: 77,260,867 (GRCm39) probably benign Het
Smarca4 G A 9: 21,612,168 (GRCm39) V1518I probably damaging Het
Smyd3 A G 1: 179,250,993 (GRCm39) probably benign Het
Sox5 A G 6: 144,155,064 (GRCm39) F11L probably benign Het
Spag17 T C 3: 100,014,143 (GRCm39) S2139P probably benign Het
Spice1 A T 16: 44,185,939 (GRCm39) probably benign Het
Sptan1 T A 2: 29,900,704 (GRCm39) probably benign Het
Srebf2 T A 15: 82,066,286 (GRCm39) N571K probably damaging Het
Tbl3 A G 17: 24,920,307 (GRCm39) L670P probably damaging Het
Tmem45a2 A G 16: 56,867,359 (GRCm39) V114A possibly damaging Het
Tmigd3 A G 3: 105,826,053 (GRCm39) N132D possibly damaging Het
Ttn T C 2: 76,567,778 (GRCm39) D19378G probably damaging Het
Ugcg C A 4: 59,189,739 (GRCm39) Y32* probably null Het
Ush2a C T 1: 188,582,301 (GRCm39) P3788L probably damaging Het
Usp22 T A 11: 61,050,023 (GRCm39) probably benign Het
Xaf1 T C 11: 72,197,381 (GRCm39) probably benign Het
Zbtb41 C T 1: 139,374,673 (GRCm39) T711I probably damaging Het
Zfp457 T C 13: 67,442,180 (GRCm39) T132A possibly damaging Het
Zfp64 T G 2: 168,754,150 (GRCm39) probably benign Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121,298,600 (GRCm39) missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121,302,116 (GRCm39) critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121,312,601 (GRCm39) missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121,310,323 (GRCm39) missense probably benign
IGL02988:Slc6a13 APN 6 121,303,066 (GRCm39) unclassified probably benign
IGL03093:Slc6a13 APN 6 121,309,407 (GRCm39) missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121,311,495 (GRCm39) missense probably benign
IGL03384:Slc6a13 APN 6 121,309,350 (GRCm39) missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121,311,835 (GRCm39) missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121,301,279 (GRCm39) missense probably damaging 0.99
R0744:Slc6a13 UTSW 6 121,279,826 (GRCm39) missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121,309,333 (GRCm39) missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121,309,328 (GRCm39) missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121,313,885 (GRCm39) missense probably benign
R1781:Slc6a13 UTSW 6 121,311,811 (GRCm39) missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121,309,332 (GRCm39) missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121,302,000 (GRCm39) missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121,313,101 (GRCm39) critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121,302,104 (GRCm39) missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121,302,008 (GRCm39) missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121,310,301 (GRCm39) missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121,313,032 (GRCm39) missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121,279,700 (GRCm39) missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121,298,587 (GRCm39) missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121,279,753 (GRCm39) missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121,311,798 (GRCm39) missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121,313,801 (GRCm39) missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121,313,798 (GRCm39) nonsense probably null
R7734:Slc6a13 UTSW 6 121,314,334 (GRCm39) missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121,298,658 (GRCm39) missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121,312,589 (GRCm39) missense probably damaging 1.00
R7935:Slc6a13 UTSW 6 121,311,450 (GRCm39) missense possibly damaging 0.46
R8177:Slc6a13 UTSW 6 121,301,987 (GRCm39) nonsense probably null
R8324:Slc6a13 UTSW 6 121,314,373 (GRCm39) makesense probably null
R8457:Slc6a13 UTSW 6 121,303,063 (GRCm39) splice site probably null
R8992:Slc6a13 UTSW 6 121,313,901 (GRCm39) nonsense probably null
R8995:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 1.00
R9104:Slc6a13 UTSW 6 121,313,044 (GRCm39) missense probably benign
R9168:Slc6a13 UTSW 6 121,302,042 (GRCm39) missense probably damaging 1.00
R9235:Slc6a13 UTSW 6 121,301,984 (GRCm39) missense probably damaging 0.98
R9242:Slc6a13 UTSW 6 121,295,228 (GRCm39) missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121,301,310 (GRCm39) critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121,311,462 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TTGGAAGCAACTGGCACACGAG -3'
(R):5'- ATGTAACACTTTCAGCCACAGGGG -3'

Sequencing Primer
(F):5'- TGGCACACGAGCCTCTTC -3'
(R):5'- TCGGCGTATGGGTACACAC -3'
Posted On 2013-05-09