Incidental Mutation 'R0230:Xaf1'
ID34068
Institutional Source Beutler Lab
Gene Symbol Xaf1
Ensembl Gene ENSMUSG00000040483
Gene NameXIAP associated factor 1
Synonyms
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0230 (G1)
Quality Score177
Status Validated
Chromosome11
Chromosomal Location72301629-72313733 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 72306555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094041] [ENSMUST00000140842] [ENSMUST00000146233] [ENSMUST00000151440]
Predicted Effect probably benign
Transcript: ENSMUST00000094041
Predicted Effect probably benign
Transcript: ENSMUST00000140842
SMART Domains Protein: ENSMUSP00000121472
Gene: ENSMUSG00000040483

DomainStartEndE-ValueType
PDB:2LXW|A 133 175 7e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142921
Predicted Effect probably benign
Transcript: ENSMUST00000146233
SMART Domains Protein: ENSMUSP00000123011
Gene: ENSMUSG00000040483

DomainStartEndE-ValueType
PDB:2LXW|A 228 270 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151440
SMART Domains Protein: ENSMUSP00000121483
Gene: ENSMUSG00000040483

DomainStartEndE-ValueType
PDB:2LXW|A 133 165 7e-9 PDB
low complexity region 194 205 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which binds to and counteracts the inhibitory effect of a member of the IAP (inhibitor of apoptosis) protein family. IAP proteins bind to and inhibit caspases which are activated during apoptosis. The proportion of IAPs and proteins which interfere with their activity, such as the encoded protein, affect the progress of the apoptosis signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Cdk5r1 T C 11: 80,477,750 L81P probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Cyp39a1 A T 17: 43,732,012 R418W probably damaging Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Ephb3 A T 16: 21,220,775 I426F probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Gss C A 2: 155,578,406 R83L probably damaging Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Map2k6 C T 11: 110,496,455 P218S probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Rxfp1 T C 3: 79,644,975 N673S probably damaging Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smarca4 G A 9: 21,700,872 V1518I probably damaging Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp457 T C 13: 67,294,116 T132A possibly damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Xaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Xaf1 APN 11 72303431 missense possibly damaging 0.80
R1955:Xaf1 UTSW 11 72306606 missense possibly damaging 0.81
R2206:Xaf1 UTSW 11 72303402 missense possibly damaging 0.85
R2207:Xaf1 UTSW 11 72303402 missense possibly damaging 0.85
R4864:Xaf1 UTSW 11 72306856 intron probably benign
R5973:Xaf1 UTSW 11 72303430 missense probably damaging 0.98
R6463:Xaf1 UTSW 11 72308638 missense probably benign 0.01
R6786:Xaf1 UTSW 11 72306635 missense probably benign 0.00
R7199:Xaf1 UTSW 11 72303375 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCGTCCAGTAAGCCTTTCCTGTG -3'
(R):5'- TCTGCCCAAAGGAAACCTTGGAAC -3'

Sequencing Primer
(F):5'- AAGCCTTTCCTGTGTGGCTAAG -3'
(R):5'- CGAAGTGTATCGAGAATCTGCTG -3'
Posted On2013-05-09