Incidental Mutation 'R0230:Cdk5r1'
ID34069
Institutional Source Beutler Lab
Gene Symbol Cdk5r1
Ensembl Gene ENSMUSG00000048895
Gene Namecyclin-dependent kinase 5, regulatory subunit 1 (p35)
SynonymsD11Bwg0379e, p35, p25
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R0230 (G1)
Quality Score176
Status Validated
Chromosome11
Chromosomal Location80477023-80481184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80477750 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 81 (L81P)
Ref Sequence ENSEMBL: ENSMUSP00000099514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000041065] [ENSMUST00000053413] [ENSMUST00000147694]
Predicted Effect probably benign
Transcript: ENSMUST00000017572
SMART Domains Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041065
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053413
AA Change: L81P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099514
Gene: ENSMUSG00000048895
AA Change: L81P

DomainStartEndE-ValueType
Pfam:CDK5_activator 69 294 1.6e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147694
AA Change: L81P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120964
Gene: ENSMUSG00000048895
AA Change: L81P

DomainStartEndE-ValueType
Pfam:CDK5_activator 1 138 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173797
SMART Domains Protein: ENSMUSP00000133739
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
Blast:PAM 2 58 9e-33 BLAST
PINT 59 142 4.34e-23 SMART
Meta Mutation Damage Score 0.6829 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of the gene results in structural abnormalities of the brain such as a small corpus callosum and delaminated cerebral cortex. Mice show hyperactivity and decreased locomotion in response to stimulants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Cyp39a1 A T 17: 43,732,012 R418W probably damaging Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Ephb3 A T 16: 21,220,775 I426F probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Gss C A 2: 155,578,406 R83L probably damaging Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Map2k6 C T 11: 110,496,455 P218S probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Rxfp1 T C 3: 79,644,975 N673S probably damaging Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smarca4 G A 9: 21,700,872 V1518I probably damaging Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Xaf1 T C 11: 72,306,555 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp457 T C 13: 67,294,116 T132A possibly damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Cdk5r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02450:Cdk5r1 APN 11 80477840 missense probably benign 0.09
IGL02754:Cdk5r1 APN 11 80477743 missense probably benign 0.00
R4166:Cdk5r1 UTSW 11 80478209 missense probably damaging 1.00
R5537:Cdk5r1 UTSW 11 80477999 missense probably damaging 1.00
R5926:Cdk5r1 UTSW 11 80478302 unclassified probably null
R6350:Cdk5r1 UTSW 11 80478242 missense probably damaging 1.00
R6841:Cdk5r1 UTSW 11 80478195 nonsense probably null
R7542:Cdk5r1 UTSW 11 80478364 missense probably damaging 1.00
T0722:Cdk5r1 UTSW 11 80477881 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGAAGGCCACACTGTTTGAGGATG -3'
(R):5'- GTCCCAAAAGGCTTCCTTACAGCTC -3'

Sequencing Primer
(F):5'- GTTTGAGGATGGCGCGG -3'
(R):5'- CTCATTGCCCATGTAGGAATAGG -3'
Posted On2013-05-09