Incidental Mutation 'R0230:Map2k6'
ID34072
Institutional Source Beutler Lab
Gene Symbol Map2k6
Ensembl Gene ENSMUSG00000020623
Gene Namemitogen-activated protein kinase kinase 6
SynonymsMAP kinase kinase 6, SAPKK3, Prkmk6, MKK6
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0230 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110399122-110525522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110496455 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 218 (P218S)
Ref Sequence ENSEMBL: ENSMUSP00000097831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020949] [ENSMUST00000100260]
Predicted Effect probably benign
Transcript: ENSMUST00000020949
AA Change: P218S

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020949
Gene: ENSMUSG00000020623
AA Change: P218S

DomainStartEndE-ValueType
S_TKc 53 314 2.82e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100260
AA Change: P218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097831
Gene: ENSMUSG00000020623
AA Change: P218S

DomainStartEndE-ValueType
Pfam:Pkinase 53 288 4.3e-47 PFAM
Pfam:Pkinase_Tyr 53 289 1.2e-32 PFAM
Pfam:Kinase-like 57 274 7.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146540
Meta Mutation Damage Score 0.4258 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null targeted mutations of this gene are viable, grow normally and have no gross physical or histologic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Cdk5r1 T C 11: 80,477,750 L81P probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Cyp39a1 A T 17: 43,732,012 R418W probably damaging Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Ephb3 A T 16: 21,220,775 I426F probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Gss C A 2: 155,578,406 R83L probably damaging Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Rxfp1 T C 3: 79,644,975 N673S probably damaging Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smarca4 G A 9: 21,700,872 V1518I probably damaging Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Xaf1 T C 11: 72,306,555 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp457 T C 13: 67,294,116 T132A possibly damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Map2k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Map2k6 APN 11 110496411 missense probably damaging 1.00
IGL01778:Map2k6 APN 11 110512869 intron probably benign
IGL02058:Map2k6 APN 11 110492583 missense probably damaging 1.00
IGL02580:Map2k6 APN 11 110490841 missense probably damaging 0.98
IGL03139:Map2k6 APN 11 110496473 splice site probably benign
Heartening UTSW 11 110492908 missense
Uplifting UTSW 11 110492562 missense probably damaging 1.00
R0361:Map2k6 UTSW 11 110499509 missense probably damaging 0.99
R0634:Map2k6 UTSW 11 110494343 nonsense probably null
R1716:Map2k6 UTSW 11 110497901 missense probably damaging 1.00
R2214:Map2k6 UTSW 11 110496341 missense probably damaging 1.00
R2279:Map2k6 UTSW 11 110499464 missense probably damaging 1.00
R4610:Map2k6 UTSW 11 110499474 missense probably damaging 1.00
R4677:Map2k6 UTSW 11 110399394 utr 5 prime probably benign
R5299:Map2k6 UTSW 11 110492963 missense probably benign 0.03
R5761:Map2k6 UTSW 11 110399371 utr 5 prime probably benign
R5996:Map2k6 UTSW 11 110497906 missense possibly damaging 0.77
R6391:Map2k6 UTSW 11 110490877 critical splice donor site probably null
R6529:Map2k6 UTSW 11 110492562 missense probably damaging 1.00
R7020:Map2k6 UTSW 11 110506714 intron probably benign
R7345:Map2k6 UTSW 11 110492908 missense
R7681:Map2k6 UTSW 11 110497903 nonsense probably null
R7980:Map2k6 UTSW 11 110499384 missense
R8087:Map2k6 UTSW 11 110490176 missense probably benign 0.00
R8093:Map2k6 UTSW 11 110482585 missense probably benign
R8531:Map2k6 UTSW 11 110399349 start gained probably benign
R8834:Map2k6 UTSW 11 110492593 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTTGGCAAAGACAGCCCTGC -3'
(R):5'- TGGGAGCGAGTGAAAATGATTTCTGAC -3'

Sequencing Primer
(F):5'- AGCCCTGCCAAGGCAAG -3'
(R):5'- AAACCTCTAAGAAAATGACACAAGG -3'
Posted On2013-05-09